
Biology: The Essentials
3rd Edition
ISBN: 9781260140705
Author: Marielle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15.3, Problem 1MC
Summary Introduction
To determine:
The evidence that proves the fact that mitochondria and chloroplast descended from cells.
Introduction:
The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?
Chapter 15 Solutions
Biology: The Essentials
Ch. 15.1 - Prob. 1MCCh. 15.1 - What we can learn from simulations of early Earth?Ch. 15.1 - Prob. 3MCCh. 15.1 - Prob. 4MCCh. 15.2 - Prob. 1MCCh. 15.2 - Without looking at figure 15.9, sketch the...Ch. 15.2 - Prob. 3MCCh. 15.2 - In what ways bacteria and archaea are essential to...Ch. 15.2 - Prob. 5MCCh. 15.3 - Prob. 1MC
Ch. 15.3 - List a logical sequence of evolutionary events...Ch. 15.4 - Prob. 1MCCh. 15.4 - Prob. 2MCCh. 15.4 - Prob. 3MCCh. 15.5 - Prob. 1MCCh. 15.5 - Prob. 2MCCh. 15.5 - Prob. 3MCCh. 15.5 - How do fungi benefit humans?Ch. 15.5 - Prob. 5MCCh. 15 - Prob. 1MCQCh. 15 - Prob. 2MCQCh. 15 - Prob. 3MCQCh. 15 - Prob. 4MCQCh. 15 - Prob. 5MCQCh. 15 - If you were developing a new broad-spectrum...Ch. 15 - Prob. 2WIOCh. 15 - Prob. 3WIOCh. 15 - Prob. 4WIOCh. 15 - Prob. 5WIOCh. 15 - Prob. 1SLCh. 15 - Review the Survey the Landscape figure in the...Ch. 15 - Prob. 2PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Biology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forwardUnit Conversions: If the field of view at 10x is 3.1x106 µm2, what would it be in mm2. Report your answer with 2 significant digits. 1 mm = 1000 µm. Include units in your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Endosymbiotic Theory; Author: Amoeba Sisters;https://www.youtube.com/watch?v=FGnS-Xk0ZqU;License: Standard Youtube License