BIOLOGY
5th Edition
ISBN: 9781265202859
Author: BROOKER
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 15, Problem 7TY
Xeroderma pigmentosum
- a. is a genetic disorder that results in uncontrolled cell growth.
- b. is a genetic disorder in which the NER system is not fully functional.
- c. is a genetic disorder that results in the loss of pigment in certain patches of skin.
- d. results from the lack of DNA polymerase proofreading.
- e. both b and d are true of this disorder.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply
a. Thread-like blood vessels in eyes
b. Excessive bleeding
c. Dwarfism
d. UV light sensitivity
e. sunburn
f. Bruises
Which of the following are characteristics of aging cells (select all that apply)?
A.
Chronic inflammation results in premature shortening of telomeres
B.
Lengthening of telomeric DNA sequence
C.
Accumulation of telomere-dysfunction–induced foci (TIFs)
D.
Older cells produce more telomerase
E.
Increased erosion of telomeres
Which of the following statements regarding loss of function and gain of function mutations is true? 
A. If both gain of function and loss of function approaches show the consistent results it is the most convincing evidence to demonstrate the function of gene
B. Gain of  function mute tapes are the most of case recessive
C. Gain of function approach is more convincing than loss of function approach
D. Over expression of a gene cannot be considered as gain of function
Chapter 15 Solutions
BIOLOGY
Ch. 15.1 - Consequences of Mutations Concept Check: Based on...Ch. 15.1 - Prob. 2CCCh. 15.2 - Prob. 1EQCh. 15.2 - Prob. 2EQCh. 15.2 - Prob. 3EQCh. 15.2 - Prob. 1CCCh. 15.3 - DNA Repair Concept Check: Which components of the...Ch. 15.3 - Why is this person so sensitive to sunlight?...Ch. 15.4 - Prob. 1CCCh. 15.4 - Prob. 2CS
Ch. 15.4 - Prob. 2CCCh. 15.4 - Prob. 3CCCh. 15.4 - Prob. 4CCCh. 15 - Prob. 1TYCh. 15 - Prob. 2TYCh. 15 - Prob. 3TYCh. 15 - Prob. 4TYCh. 15 - Prob. 5TYCh. 15 - The Ames test a. provides a way to determine if...Ch. 15 - Xeroderma pigmentosum a. is a genetic disorder...Ch. 15 - Prob. 8TYCh. 15 - Prob. 9TYCh. 15 - Prob. 10TYCh. 15 - Prob. 1CQCh. 15 - Prob. 2CQCh. 15 - Prob. 3CQCh. 15 - Prob. 1COQCh. 15 - Distinguish between spontaneous and induced...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Calculate the lattice energy of CaCl2 using a Born-Haber cycle and data from Appendices F and L and Table 7.5. ...
Chemistry & Chemical Reactivity
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus (2nd Edition)
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is NOT common to all repair mechanisms? A. Detection of the lesion B. Removal of the damaged DNA sequence/ nucleotide/ base C. Removal of free radicals at the site of injury D. Repair of the lesion E. Involvement of enzymes in removing the lesion and/or repair of the damaged sequence/nucleotide/base.arrow_forwardWhich of the following methods might have a clue whether child suffering from genetic disease a was missing a large chunk of the jean that one defective caused the genetic disorder?arrow_forwardIf two mutational events are sufficient to cause some forms of cancer, what distinguishes familial forms (i.e. those that "run in families") of cancer from spontaneous cases? A. spontaneous forms inherit both mutations B. familial forms are caused by chance alone C. familial forms inherit one mutation D. there is no difference E. none of the abovearrow_forward
- The BRCA genes produce DNA repair proteins. Genetic testing is available that can determine if a person has a mutation in the BRCA genes that makes the proteins less able to function. What is the result of a BRCA mutation? A. The person is more likely to develop cancer if other DNA in the cell mutates. B. The person is less likely to develop cancer unless the BRCA region is methylated. C. The person is less likely to develop cancer because the BRCA gene will inhibit the cell cycle checkpoints. D. The person is more likely to develop cancer because the BRCA gene promotes an increased rate for mitosis.arrow_forwardWith regard to cancer cells, which of the following are true? A. Cancer cells are clonal, meaning that they are derived from many different cells that all underwent the same clonal mutation. Cells usually accumulate many mutations over time, and this results in cancerous growth. B. Almost all cancers are caused by oncogenic viruses. no Benign tumors are dangerous because they can easily invade surrounding tissue and spread to other locations in the body. DE. Cancer cells are unable to control their division.arrow_forwardIn general, all mutations can be considered harmful, because most genetic systems are already optimized to work correctly and efficiently. A. True b. False; mutations are considered harmful only if they have a direct effect on the ability of cells to synthesize DNA c. False; some mutations are harmful, and some are considered beneficialarrow_forward
- Defects in the excision repair process may result in : A. Mutations B. Okazaki fragments C. Excess DNA polymerase activity D. Shortened telomeresarrow_forwardWhen using gene therapy to treat an hereditary disease, the idea is to: A. Introduce the correct gene into the patient's DNA B. Inject the patient with a specific protein to cure the disease. C. Blood transfusions from healthy individuals. D. ntroduce mRNA molecules with the correct genetic information to the patient. E. Introduce a virus to the patient that will specifically destroy mutated cells.arrow_forwardSuppose that you could undergo genetic testing at age 18 for susceptibility to a genetic disease that would not appear until middle age and has no available treatment. a. What would be some of the possible reasons for having such a genetic test and some of the possible reasons for not having the test? b. Would you personally want to be tested? Explain your reasoning.arrow_forward
- The BRCA genes produce DNA repair proteins. Genetic testing is available that can determine if a person has a mutation in the BRCA genes that makes the proteins less able to function. What is the result of a BRCA mutation? A. The person is more likely to develop cancer if other DNA in the cell mutates. O B. The person is less likely to develop cancer unless the BRCA region is methylated. O C. The person is less likely to develop cancer because the BCA gene will inhibit the cell cycle checkpoints. D. The person is more likely to develop cancer because the BRCA gene promotes an increased rate for mitosis. swered MacBool F1 F2 F3 D00 F4 F5 F6 F7 F8 $ % & * 2 云 # 3arrow_forwardFrom the list of answers below (A-D) select the correct answer(s). There may be more than one correct answer. B. Identical twins have the same genome, as well as the same epigenome. C. Epigenetic changes can be introduced or changed by social experience. D. Epigenetic changes are permanent and once acquired can never be changed. A. Identical twins have the same genome, but may have different epigenomes.arrow_forwardWhat unusual phenomenon is at work in each of the following disorders?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Cancer Types SIMPLY explained! MEMORIZE them QUICKLY and EASILY!; Author: CancerEdInstitute;https://www.youtube.com/watch?v=dEBi-yvSWmQ;License: Standard Youtube License