Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
12th Edition
ISBN: 9780134811390
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 15, Problem 26ESP
Summary Introduction
To determine: The evidence which suggests that human-made forms of radiation are a major contributor of mutations in humans.
Introduction: Mutation refers to permanent alteration in the deoxyribonucleotide (DNA) sequence of an organism. Various types of mutations are substitution, insertion, deletion, and frameshift mutation. These mutations could be beneficial, neutral, or harmful.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A mutation is most often cause by which of the following factors?
a) Sunlight
b) Smoking
c) Random Copy error
d) Radiation
I read that vinyl chloride exposure is associated with an increased risk of a rare form of liver cancer (hepatic angiosarcoma), as well as brain and lung cancers, lymphoma, and leukemia. But my question is what gene(s) are being mutated by this type of taxic gas?
Which, if any, of the following statements is false?
a) Most of the inherited changes in our DNA arise because of exposure to extracellular mutagens, including radiation sources and chemical mutagens.
b) Most of the inherited changes in our DNA arise because of unavoidable endogenous errors in cellular mechanisms and harmful effects of certain natural molecules and atoms within our cells.
c) Errors in DNA replication and DNA repair are a major source of mutations in our cells.
d) Significant chemical damage is sustained by DNA because of its proximity to water molecules in our cells.
Chapter 15 Solutions
Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
Ch. 15 - If a point mutation occurs within a human egg cell...Ch. 15 - One of the most famous cases of an X-linked...Ch. 15 - The cancer drug melphalan is an alkylating agent...Ch. 15 - Geneticists often use the alkylating agent...Ch. 15 - Six months pregnant, an expectant mother had a...Ch. 15 - Six months pregnant, an expectant mother had a...Ch. 15 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 15 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 15 - What is a spontaneous mutation, and why are...Ch. 15 - Prob. 4PDQ
Ch. 15 - Prob. 5PDQCh. 15 - Why is a random mutation more likely to be...Ch. 15 - Most mutations in a diploid organism are...Ch. 15 - What is the difference between a silent mutation...Ch. 15 - Describe a tautomeric shift and how it may lead to...Ch. 15 - Contrast and compare the mutagenic effects of...Ch. 15 - Why are frameshift mutations likely to be more...Ch. 15 - Why are X rays more potent mutagens than UV...Ch. 15 - DNA damage brought on by a variety of natural and...Ch. 15 - Contrast the various types of DNA repair...Ch. 15 - Mammography is an accurate screening technique for...Ch. 15 - A significant number of mutations in the HBB gene...Ch. 15 - Describe how the Ames test screens for potential...Ch. 15 - Prob. 18PDQCh. 15 - Compare DNA transposons and retrotransposons. What...Ch. 15 - Prob. 20PDQCh. 15 - In maize, a Ds or Ac transposon can alter the...Ch. 15 - Prob. 22PDQCh. 15 - In a bacterial culture in which all cells are...Ch. 15 - Presented here are hypothetical findings from...Ch. 15 - Prob. 25ESPCh. 15 - Prob. 26ESPCh. 15 - What evidence indicates that mutations in human...Ch. 15 - Among Betazoids in the world of Star Trek, the...Ch. 15 - Skin cancer carries a lifetime risk nearly equal...Ch. 15 - It has been noted that most transposons in humans...Ch. 15 - Mutations in the IL2RG gene cause approximately 30...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forwardGene mutations can be classified in two major ways:(1) hereditary or germline mutations that are inherited from a parent and are present throughout a person’s life in virtually every cell in the body.(2) acquired or somatic mutations that occur at some time during a person’s life and are present only in certain cells, not in every cell in the body.If there is no family history of a particular disease but a child has the disease then it may have arisen due to a(n) ________ mutation early during development. A) acquired B) inherited C) silent D) transitionarrow_forwardYou are working in the lab with two known carcinogens found in cigarette smoke: Benzo(a)pyren (BaP) and nitrosamine ketone (NNK). BaP is an aromatic hydrocarbon and the mechanism of carcinogenesis is through oxidation reactions with DNA. NNK is a nitrosoamine. Describe how these two kinds of carcinogens lead to mutations. (Be detailed. Remember you are graded on effort/completeness.)arrow_forward
- Which of the following is an enabling characteristic for cancer that can increase the likelihood of both passenger and driver mutations? a) Increased angiogenesis O b) Tumor-promoting inflammation O c) Avoiding immune destruction O d) Genome instability acerarrow_forwardA neutral mutation is, by definition, a mutation that does not result in the change of the encoded amino acid sequence of a gene. 1)True 2)Falsearrow_forwardIn the replica plate experiment, it shows that mutations are random. However, certain environmental stresses (such as high temperature, high salt, and low pH) can increase the mutation rate. QUESTIONS: Does this indicate that mutations are nonrandom, since they increase in response to cell stressors?arrow_forward
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?arrow_forwardHow do we know that mutations occur spontaneously?arrow_forward
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardTwo possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?arrow_forwardTrue or False? Mutations are never introduced during normal cellular processes in the eukaryotic cell.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What is cancer? What causes cancer and how is it treated? *UPDATE*; Author: Cancer Treatment Centers of America - CTCA;https://www.youtube.com/watch?v=_N1Sk3aiSCE;License: Standard Youtube License