
Concept explainers
The experiments with nutritional mutants in Neurospora by Beadle and Tatum provided evidence that
a. bread mold can be grown in a lab on minimal media.
b. X-rays can damage DNA.
c. cells need enzymes.
d. genes specify enzymes.

Introduction:
To identify the working nature of genes, scientists from all over the world conducted various experiments. The results revealed by them include, the functions controlled by the genes and the enzymes specified by the genes.
Answer to Problem 1U
Correct answer:
The experiments with nutritional mutants in Neurospora by Beadle and Tatum provided evidence that genes specify enzymes. Therefore, option d. is correct.
Explanation of Solution
Reason for the correct statement:
Beadle and Tatum showed that genes specify enzymes. In neurospora, each enzyme of the arginine pathway was encoded by a separate gene. The mutant species of neurospora were unable to synthesize arginine. Beadle and Tatum found that specific enzymes controlled by specific genes were absent in the mutant neurospora. They proposed the one gene-one enzyme hypothesis.
Option d. is given as "genes specify enzymes".
As, “the experiments with nutritional mutants in Neurospora by Beadle and Tatum provided evidence that genes specify enzymes”, it is the right answer.
Hence, the option d. is correct.
Reasons for the incorrect statements:
Option a. is given as “bread mold can be grown in a lab on minimal media”.
In the experiments conducted by Beadle and Tatum, bread mold was grown to determine the enzymes specific for the growth. So, it is a wrong answer.
Option b. is given as “X-rays can damage DNA”.
The experiments conducted by Beadle and Tatum to determine the limiting factors for specific enzymes and not to determine what X-rays do to the DNA. So, it is a wrong answer.
Option c. is given as “cells need enzymes”.
The experiments conducted by Beadle and Tatum were performed to determine the limiting factors, which control synthesis of enzymes responsible for specific functions. So, it is a wrong answer.
Hence, the options a., b., and c. are incorrect.
The experiments with nutritional mutants in Neurospora by Beadle and Tatum provided evidence that genes specify enzymes.
Want to see more full solutions like this?
Chapter 15 Solutions
Biology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Understanding Nutrition (MindTap Course List)Health & NutritionISBN:9781337392693Author:Eleanor Noss Whitney, Sharon Rady RolfesPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning




