
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14.6, Problem 1HYEW
Summary Introduction
To determine:
The consequences if the food that has been taken is genetically modified.
Introduction:
Organisms that contain recombinant DNA or modified DNA derived from other species through genetic engineering are called transgenic or genetically modified organisms (GMOs). Transgenic organisms are widely used in agriculture and biomedical research. Many crops and animals are genetically modified to meet the demands of growing human population.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 14 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 14.1 - define biotechnology?Ch. 14.1 - Prob. 2CYLCh. 14.1 - define GMO and transgenic organism?Ch. 14.2 - describe natural processes that recombine DNA,...Ch. 14.3 - Prob. 1CSCCh. 14.3 - Prob. 1CYLCh. 14.3 - summarize how CRISPR-Cas9 works and explain why it...Ch. 14.4 - For any single person, a given STR always has...Ch. 14.4 - There are many other applications in which DNA...Ch. 14.4 - Prob. 1CYL
Ch. 14.4 - Prob. 2CYLCh. 14.5 - Restriction enzymes are isolated from bacteria....Ch. 14.5 - Many countries regulate the use of genetically...Ch. 14.5 - explain how genes are inserted into a plasmid, and...Ch. 14.5 - Prob. 2CYLCh. 14.6 - Prob. 1CTCh. 14.6 - Prob. 1HYEWCh. 14.6 - describe the advantages of genetically modified...Ch. 14.6 - list some examples of how genetically modified...Ch. 14.6 - Prob. 3CYLCh. 14.7 - Explain how fetal DNA could be used to establish...Ch. 14.7 - explain how biotechnology is used to diagnose both...Ch. 14.7 - describe how transgenic organisms are used to...Ch. 14.7 - describe the procedures and advantages of gene...Ch. 14.8 - explain why people might be opposed to the use of...Ch. 14.8 - Prob. 2CYLCh. 14.8 - Prob. 1CTCh. 14 - Prob. 1MCCh. 14 - Prob. 3MCCh. 14 - A restriction enzyme a. cuts DNA at a specific...Ch. 14 - Prob. 5MCCh. 14 - Prob. 1FIBCh. 14 - _________is the process whereby bacteria pick up...Ch. 14 - The _______ is a technique tor multiplying DNA in...Ch. 14 - Matching DNA samples in forensics uses a specific...Ch. 14 - Prob. 5FIBCh. 14 - Describe two natural forms of genetic...Ch. 14 - Prob. 2RQCh. 14 - Prob. 3RQCh. 14 - Prob. 4RQCh. 14 - Prob. 5RQCh. 14 - Prob. 6RQCh. 14 - How does gel electrophoresis separate pieces of...Ch. 14 - Prob. 8RQCh. 14 - Prob. 9RQCh. 14 - Prob. 10RQCh. 14 - As you may know, many Insects have evolved...Ch. 14 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax


Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Industrial Processes and By-products | 9-1 GCSE Chemistry | OCR, AQA, Edexcel; Author: SnapRevise;https://www.youtube.com/watch?v=CMLKgqEMXwc;License: Standard Youtube License