
Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14.4, Problem 6CYU
Summary Introduction
To review:
Whether short preganglionic fibers, terminal ganglia, collateral ganglia, origin from the thoracolumbar region of the spinal cord, and innervates adrenal medulla are the characteristic feature of sympathetic or parasympathetic nervous system.
Introduction:
The ANS (autonomic nervous system) is comprised of two units that are the parasympathetic nervous system and SNS (sympathetic nervous system). ANS is involuntary control of the body tissues. The spinal cord comprises 31 pairs of segments and is important because the sympathetic and parasympathetic nerves arise from them.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 14 Solutions
Anatomy & Physiology (6th Edition)
Ch. 14.1 - Name the three types of effectors of the autonomic...Ch. 14.1 - Which relays instructions from the CNS to muscles...Ch. 14.1 - MAKING CONNECTIONS The cell bodies of autonomic...Ch. 14.2 - Which branch of the ANS would predominate if you...Ch. 14.3 - In general terms, where are the cell bodies of...Ch. 14.4 - Prob. 6CYUCh. 14.5 - Prob. 7CYUCh. 14.6 - Prob. 8CYUCh. 14.7 - Prob. 9CYUCh. 14.8 - Prob. 10CYU
Ch. 14.9 - Prob. 11CYUCh. 14 - All of the following characterize the ANS except...Ch. 14 - Relate each of the following terms or phrases to...Ch. 14 - The white rami communicates contain what kind of...Ch. 14 - Collateral sympathetic ganglia are involved with...Ch. 14 - Briefly explain why the following terms are...Ch. 14 - Describe the anatomical relationship of the white...Ch. 14 - Prob. 7SAQCh. 14 - Which of the effects listed in response to...Ch. 14 - Which ANS fibers release acetylcholine? Which...Ch. 14 - Describe the meaning and importance of sympathetic...Ch. 14 - Prob. 11SAQCh. 14 - Describe the importance of the hypothalamus in...Ch. 14 - Postganglionic neurons are also called ganglionic...Ch. 14 - 10-Year-Old Boy with Spinal Injury On arrival at...Ch. 14 - 10-Year-Old Boy with Spinal Injury On arrival at...Ch. 14 - 10-Year-Old Boy with Spinal Injury On arrival at...Ch. 14 - Prob. 4CCSCh. 14 - 10-Year-Old Boy with Spinal Injury On arrival at...Ch. 14 - Prob. 6CCSCh. 14 - 10-Year-Old Boy with Spinal Injury On arrival at...Ch. 14 - Prob. 8CCS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning