
Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14.3, Problem 8AYP
Summary Introduction
To enlist:
The difference between whole blood, plasma and serum
Concept introduction:
Plasma is defined as the blood liquid component, in which RBC (red blood cells), white blood cells, and platelets are also present. Plasma constitutes half of the blood volume and main protein in plasma is albumin.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 14 Solutions
Microbiology: A Systems Approach
Ch. 14.1 - Summarize the three lines of host defenses.Ch. 14.1 - Identify two components of the first line of...Ch. 14.1 - Discuss the role of normal biota as a first-line...Ch. 14.2 - Define marker, and discuss its importance in the...Ch. 14.3 - Prob. 5AYPCh. 14.3 - List the components of the mononuclear phagocyte...Ch. 14.3 - Prob. 7AYPCh. 14.3 - Prob. 8AYPCh. 14.3 - Name six types of blood cells that function in...Ch. 14.3 - Prob. 10AYP
Ch. 14.4 - List the four major categories of nonspecific...Ch. 14.4 - Summarize the steps in phagocytosis, and describe...Ch. 14.4 - Outline the steps in inflammation.Ch. 14.4 - Discuss the mechanism of fever and its role in...Ch. 14.4 - Compare and contrast the three different...Ch. 14.4 - Name three types of antimicrobial proteins.Ch. 14 - Ail example of a nonspecific chemical barrier to...Ch. 14 - Which nonspecific host defense is associated with...Ch. 14 - Prob. 3MCQCh. 14 - Which of the following is not a lymphoid tissue?...Ch. 14 - Prob. 5MCQCh. 14 - Prob. 6MCQCh. 14 - Prob. 7MCQCh. 14 - Prob. 8MCQCh. 14 - Which of the following substances is/are not...Ch. 14 - Which of the following is the end product of the...Ch. 14 - The liquid component of clotted blood is called...Ch. 14 - Prob. 12TFCh. 14 - Prob. 13TFCh. 14 - Prob. 14TFCh. 14 - Prob. 15TFCh. 14 - Prob. 1CTQCh. 14 - Prob. 2CTQCh. 14 - Prob. 3CTQCh. 14 - a. Inflammation is characterized by heat, pain,...Ch. 14 - HIV predominantly infects T helper cells, cells...Ch. 14 - Prob. 1VCCh. 14 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning