Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14, Problem 5RQ
Summary Introduction
Introduction: Heart pumps the oxygenated blood in the body with the help of arteries and arterioles. Veins carry deoxygenated blood to the heart. The flow of blood though the blood vessels depend upon three factors: peripheral resistance, the diameter of the blood vessels, and volume of the blood.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 14 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 14 - A cardiovascular system has what three major...Ch. 14 - What is the difference between (a) the pulmonary...Ch. 14 - Which is more important for determining flow...Ch. 14 - The two identical tubes below have the pressures...Ch. 14 - All four tubes below have the same driving...Ch. 14 - Two canals in Amsterdam are identical in size, but...Ch. 14 - What prevents electrical signals from passing...Ch. 14 - Prob. 8CCCh. 14 - Prob. 9CCCh. 14 - Compare the receptors and channels involved in...
Ch. 14 - If a myocardial contractile cell is placed in...Ch. 14 - A drug that blocks all Ca2+ channels in the...Ch. 14 - Which ions moving in what directions cause the...Ch. 14 - At the molecular level, what is happening during...Ch. 14 - Lidocaine is a molecule that blocks the action of...Ch. 14 - What does increasing K+ permeability do to the...Ch. 14 - A new cardiac drug called ivabradine selectively...Ch. 14 - Do you think that the Ca2+ channels in...Ch. 14 - What happens to the action potential of a...Ch. 14 - In an experiment, the vagus nerve, which carries...Ch. 14 - Name two functions of the AV node. What is the...Ch. 14 - Prob. 22CCCh. 14 - Occasionally an ectopic pacemaker {ktopos, out of...Ch. 14 - Prob. 24CCCh. 14 - Which chamberatrium or ventriclehas higher...Ch. 14 - Prob. 26CCCh. 14 - Prob. 27CCCh. 14 - Prob. 28CCCh. 14 - Prob. 29CCCh. 14 - Why does ventricular pressure shoot up suddenly at...Ch. 14 - Prob. 31CCCh. 14 - Prob. 32CCCh. 14 - A persons aortic valve opening has become...Ch. 14 - What contributions to understanding the...Ch. 14 - List three functions of the cardiovascular system.Ch. 14 - Prob. 3RQCh. 14 - Prob. 4RQCh. 14 - Prob. 5RQCh. 14 - Prob. 6RQCh. 14 - Prob. 7RQCh. 14 - Distinguish between the two members of each of the...Ch. 14 - Prob. 9RQCh. 14 - Prob. 10RQCh. 14 - What is the proper term for each of the following?...Ch. 14 - List the events of the cardiac cycle in sequence,...Ch. 14 - Prob. 13RQCh. 14 - Compare and contrast the structure of a cardiac...Ch. 14 - Prob. 15RQCh. 14 - Correlate the waves of an ECG with mechanical...Ch. 14 - Prob. 17RQCh. 14 - List and briefly explain four types of information...Ch. 14 - Define inotropic effect. Name two drugs that have...Ch. 14 - Prob. 20RQCh. 14 - Police Captain Jeffers has suffered a myocardial...Ch. 14 - Prob. 22RQCh. 14 - Prob. 23RQCh. 14 - Police Captain Jeffers in question 21 has an...Ch. 14 - Prob. 25RQCh. 14 - Prob. 26RQCh. 14 - Prob. 27RQCh. 14 - A person has a total blood volume of 5 L. Of this...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
12DaysinMarch, Genital Infections for USMLE Step One; Author: Howard Sachs;https://www.youtube.com/watch?v=66zR_FypVFQ;License: Standard youtube license