
Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14, Problem 5RQ
Summary Introduction
To describe: The working mechanism of CRISPR-Cas9 tool.
Introduction: Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a powerful
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 14 Solutions
Biology
Ch. 14.1 - define biotechnology?Ch. 14.1 - Prob. 2CYLCh. 14.1 - define GMO and transgenic organism?Ch. 14.2 - describe natural processes that recombine DNA,...Ch. 14.3 - Prob. 1CSCCh. 14.3 - Prob. 1CYLCh. 14.3 - summarize how CRISPR-Cas9 works and explain why it...Ch. 14.4 - For any single person, a given STR always has...Ch. 14.4 - There are many other applications in which DNA...Ch. 14.4 - Prob. 1CYL
Ch. 14.4 - Prob. 2CYLCh. 14.5 - Restriction enzymes are isolated from bacteria....Ch. 14.5 - Many countries regulate the use of genetically...Ch. 14.5 - explain how genes are inserted into a plasmid, and...Ch. 14.5 - Prob. 2CYLCh. 14.6 - Prob. 1CTCh. 14.6 - Prob. 1HYEWCh. 14.6 - describe the advantages of genetically modified...Ch. 14.6 - list some examples of how genetically modified...Ch. 14.6 - Prob. 3CYLCh. 14.7 - Explain how fetal DNA could be used to establish...Ch. 14.7 - explain how biotechnology is used to diagnose both...Ch. 14.7 - describe how transgenic organisms are used to...Ch. 14.7 - describe the procedures and advantages of gene...Ch. 14.8 - explain why people might be opposed to the use of...Ch. 14.8 - Prob. 2CYLCh. 14.8 - Prob. 1CTCh. 14 - Prob. 1MCCh. 14 - Prob. 3MCCh. 14 - A restriction enzyme a. cuts DNA at a specific...Ch. 14 - Prob. 5MCCh. 14 - Prob. 1FIBCh. 14 - _________is the process whereby bacteria pick up...Ch. 14 - The _______ is a technique tor multiplying DNA in...Ch. 14 - Matching DNA samples in forensics uses a specific...Ch. 14 - Prob. 5FIBCh. 14 - Describe two natural forms of genetic...Ch. 14 - Prob. 2RQCh. 14 - Prob. 3RQCh. 14 - Prob. 4RQCh. 14 - Prob. 5RQCh. 14 - Prob. 6RQCh. 14 - How does gel electrophoresis separate pieces of...Ch. 14 - Prob. 8RQCh. 14 - Prob. 9RQCh. 14 - Prob. 10RQCh. 14 - As you may know, many Insects have evolved...Ch. 14 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeEssentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:CengageBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Essentials Health Info Management Principles/Prac...
Health & Nutrition
ISBN:9780357191651
Author:Bowie
Publisher:Cengage

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License