Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13.7, Problem 1MQ
- How are DNA sequences obtained for phylogenetic analysis?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 13 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 13.1 - What characteristics would have made the surface...Ch. 13.1 - How do we know when oceans were first present on...Ch. 13.1 - What lines of reasoning support the hypothesis...Ch. 13.1 - What is LUCA, and what is a plausible explanation...Ch. 13.2 - Why is the origin of cyanobacteria considered a...Ch. 13.2 - What caused the development of banded iron...Ch. 13.2 - What lines of evidence indicate that microbial...Ch. 13.2 - Why was the origin of cyanobacteria of such...Ch. 13.3 - What kinds of evidence support the three-domain...Ch. 13.3 - What is LUCA and what are some of its...
Ch. 13.3 - Which of the three domains is the least ancient?Ch. 13.3 - What evidence supports the classification of life...Ch. 13.4 - What evidence supports the idea that the...Ch. 13.4 - In what ways are modern eukaryotes a combination...Ch. 13.4 - Describe the different hypotheses for the...Ch. 13.4 - What is the endosymbiotic hypothesis for the...Ch. 13.5 - What are the different processes that give rise to...Ch. 13.5 - What is the difference between selection and...Ch. 13.5 - In the experiment of Figure 13.12, why did the...Ch. 13.5 - What is fitness? To what degree does fitness...Ch. 13.6 - What is the difference between the core and pan...Ch. 13.6 - What kind of recombination might have the greatest...Ch. 13.6 - What effects do deletions have on the evolution of...Ch. 13.6 - What are some processes that influence the content...Ch. 13.7 - How are DNA sequences obtained for phylogenetic...Ch. 13.7 - What does a phylogenetic tree depict?Ch. 13.7 - Prob. 3MQCh. 13.7 - What is the difference between a gene tree and an...Ch. 13.8 - What is the difference between taxonomy and...Ch. 13.8 - What are some key criteria from the phylogenetic...Ch. 13.8 - How many species of Bacteria and Archaea have been...Ch. 13.8 - What is the "species problem" and why is the...Ch. 13.9 - What class of genes is used in MLST analyses?Ch. 13.9 - How is ribotyping different from rep-PCR?Ch. 13.9 - What is FAME analysis?Ch. 13.9 - Prob. 1CRCh. 13.10 - What roles do culture collections play in...Ch. 13.10 - What is the IJSEM and what taxonomic function does...Ch. 13.10 - Why might viable cell cultures be of more use in...Ch. 13.10 - Prob. 1CRCh. 13 - Compare and contrast the physical and chemical...Ch. 13 - For the following sequences, construct the...Ch. 13 - Imagine that you have been given several bacterial...Ch. 13 - Imagine that you have discovered a new form of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License