Brock Biology of Microorganisms (15th Edition)
Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 13.7, Problem 1MQ
  • How are DNA sequences obtained for phylogenetic analysis?
Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 13 Solutions

Brock Biology of Microorganisms (15th Edition)

Ch. 13.3 - Which of the three domains is the least ancient?Ch. 13.3 - What evidence supports the classification of life...Ch. 13.4 - What evidence supports the idea that the...Ch. 13.4 - In what ways are modern eukaryotes a combination...Ch. 13.4 - Describe the different hypotheses for the...Ch. 13.4 - What is the endosymbiotic hypothesis for the...Ch. 13.5 - What are the different processes that give rise to...Ch. 13.5 - What is the difference between selection and...Ch. 13.5 - In the experiment of Figure 13.12, why did the...Ch. 13.5 - What is fitness? To what degree does fitness...Ch. 13.6 - What is the difference between the core and pan...Ch. 13.6 - What kind of recombination might have the greatest...Ch. 13.6 - What effects do deletions have on the evolution of...Ch. 13.6 - What are some processes that influence the content...Ch. 13.7 - How are DNA sequences obtained for phylogenetic...Ch. 13.7 - What does a phylogenetic tree depict?Ch. 13.7 - Prob. 3MQCh. 13.7 - What is the difference between a gene tree and an...Ch. 13.8 - What is the difference between taxonomy and...Ch. 13.8 - What are some key criteria from the phylogenetic...Ch. 13.8 - How many species of Bacteria and Archaea have been...Ch. 13.8 - What is the "species problem" and why is the...Ch. 13.9 - What class of genes is used in MLST analyses?Ch. 13.9 - How is ribotyping different from rep-PCR?Ch. 13.9 - What is FAME analysis?Ch. 13.9 - Prob. 1CRCh. 13.10 - What roles do culture collections play in...Ch. 13.10 - What is the IJSEM and what taxonomic function does...Ch. 13.10 - Why might viable cell cultures be of more use in...Ch. 13.10 - Prob. 1CRCh. 13 - Compare and contrast the physical and chemical...Ch. 13 - For the following sequences, construct the...Ch. 13 - Imagine that you have been given several bacterial...Ch. 13 - Imagine that you have discovered a new form of...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License