
Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13.2, Problem 1MQ
- Why is the origin of cyanobacteria considered a critical step in evolution?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 13 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 13.1 - What characteristics would have made the surface...Ch. 13.1 - How do we know when oceans were first present on...Ch. 13.1 - What lines of reasoning support the hypothesis...Ch. 13.1 - What is LUCA, and what is a plausible explanation...Ch. 13.2 - Why is the origin of cyanobacteria considered a...Ch. 13.2 - What caused the development of banded iron...Ch. 13.2 - What lines of evidence indicate that microbial...Ch. 13.2 - Why was the origin of cyanobacteria of such...Ch. 13.3 - What kinds of evidence support the three-domain...Ch. 13.3 - What is LUCA and what are some of its...
Ch. 13.3 - Which of the three domains is the least ancient?Ch. 13.3 - What evidence supports the classification of life...Ch. 13.4 - What evidence supports the idea that the...Ch. 13.4 - In what ways are modern eukaryotes a combination...Ch. 13.4 - Describe the different hypotheses for the...Ch. 13.4 - What is the endosymbiotic hypothesis for the...Ch. 13.5 - What are the different processes that give rise to...Ch. 13.5 - What is the difference between selection and...Ch. 13.5 - In the experiment of Figure 13.12, why did the...Ch. 13.5 - What is fitness? To what degree does fitness...Ch. 13.6 - What is the difference between the core and pan...Ch. 13.6 - What kind of recombination might have the greatest...Ch. 13.6 - What effects do deletions have on the evolution of...Ch. 13.6 - What are some processes that influence the content...Ch. 13.7 - How are DNA sequences obtained for phylogenetic...Ch. 13.7 - What does a phylogenetic tree depict?Ch. 13.7 - Prob. 3MQCh. 13.7 - What is the difference between a gene tree and an...Ch. 13.8 - What is the difference between taxonomy and...Ch. 13.8 - What are some key criteria from the phylogenetic...Ch. 13.8 - How many species of Bacteria and Archaea have been...Ch. 13.8 - What is the "species problem" and why is the...Ch. 13.9 - What class of genes is used in MLST analyses?Ch. 13.9 - How is ribotyping different from rep-PCR?Ch. 13.9 - What is FAME analysis?Ch. 13.9 - Prob. 1CRCh. 13.10 - What roles do culture collections play in...Ch. 13.10 - What is the IJSEM and what taxonomic function does...Ch. 13.10 - Why might viable cell cultures be of more use in...Ch. 13.10 - Prob. 1CRCh. 13 - Compare and contrast the physical and chemical...Ch. 13 - For the following sequences, construct the...Ch. 13 - Imagine that you have been given several bacterial...Ch. 13 - Imagine that you have discovered a new form of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Endosymbiotic Theory; Author: Amoeba Sisters;https://www.youtube.com/watch?v=FGnS-Xk0ZqU;License: Standard Youtube License