
Concept explainers
Why is the white-eye
a. Because the trait is dominant
b. Because the trait is recessive
c. Because the allele is located on the X chromosome and males only have one X
d. Because the allele is located on the Y chromosome and only males have Y chromosomes

Introduction:
The sex chromosomes are those chromosomes that determine the sex of the organism. The females have a pair of X chromosomes, whereas, the males have a pair of dissimilar chromosomes (one X chromosome and one Y chromosome).
Answer to Problem 1U
Correct answer:
The white-eye phenotype is always observed in males carrying the white-eye allele because the allele is located on the X chromosome and males only have one X chromosome. Therefore, option c. is correct.
Explanation of Solution
Reason for the correct statement:
The gene responsible for the appearance of the white eye phenotype is present only on the X chromosome and it is not present on the Y chromosome.
Option c. is given as “because the allele is located on the X chromosome and males only have one X”.
As, “the Y chromosome lacks the gene responsible for the expression of the white eye phenotype and X chromosome has it. It is observed only in the males”, it is the right answer.
Hence, option c. is correct.
Reasons for the incorrect statements:
Option a. is given as “Because the trait is dominant”.
The trait will be dominant if it is expressing in the heterozygous or homozygous dominant conditions. Here, it cannot be determined that whether the condition is dominant or not. So, it is a wrong answer.
Option b. is given as “Because the trait is recessive”.
The trait will be recessive if it is expressing in the homozygous recessive conditions. Here, it cannot be determined that whether the condition is homozygous or not. So, it is a wrong answer.
Option d. is given as “Because the allele is located on the Y chromosome and only males have Y chromosomes”.
The allele for the gene responsible is not present on the Y chromosome. So, it is a wrong answer.
Hence, options a., b., and d. are incorrect.
The gene responsible for the white eye phenotype is present on the X chromosome only and males only have X chromosome and the Y chromosome does not have that gene.
Want to see more full solutions like this?
Chapter 13 Solutions
Biology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning





