Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11.1, Problem 3EQ
CoreSKILL » In the experiment of Avery, MacLeod, and McCarty, what was the purpose of using protease, RNase, and DNase if only the DNA extract caused transformation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In relation to DNA Isolation experiment
1. Once the tissue has been ground and heated to 60°C, the DNA is released into the
solution, but so are many other types of cellular molecules. List some types of
molecules besides DNA that you would expect to find in a cell.
2. What is the role of the detergent in this protocol? How does it perform this function?
3. Name two important functions of the proteases?
4. If you wanted to isolate a copy of the gene that codes for a protein found in the skin,
could that gene be located in liver cells? Explain your reasoning
5. What do you think will be the first step in purifying DNA from intact isolated cells?
6. What happened to the other macromolecules once the DNA was precipitated out of
solution?
What molecular biology strategy can best be used to determine Inhibition of DNA synthesis? Explain.
Home Work:
• Suppose you perform a PCR that begins with one double-strand of the
following DNA template:
+5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3—
::::::::::::
:::::::::::: ::::
+3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+
A. Draw one cycle of PCR reaction below the following diagram.
B. Label the template DNA, the primers, and what is happening at each step.
(1)
température
cycle #1
Chapter 11 Solutions
Biology
Ch. 11.1 - Prob. 1CSCh. 11.1 - Prob. 1EQCh. 11.1 - Prob. 2EQCh. 11.1 - CoreSKILL In the experiment of Avery, MacLeod,...Ch. 11.2 - Prob. 1CCCh. 11.2 - Prob. 2CCCh. 11.2 - Core Skill: Modeling The goal of this modeling...Ch. 11.2 - Prob. 2CSCh. 11.3 - If this experiment was conducted for four rounds...Ch. 11.4 - Molecular Mechanism of DNA Replication Concept...
Ch. 11.4 - Prob. 2CCCh. 11.4 - Prob. 3CCCh. 11.4 - Prob. 4CCCh. 11.5 - Prob. 1CCCh. 11.5 - Prob. 1CSCh. 11 - Why did researchers initially believe that the...Ch. 11 - Prob. 2TYCh. 11 - Which of the following equations is accurate...Ch. 11 - Prob. 4TYCh. 11 - Which of the following statements about the...Ch. 11 - Meselson and Stahl were able to demonstrate...Ch. 11 - During replication of a DNA molecule, the daughter...Ch. 11 - Prob. 8TYCh. 11 - A nucleosome is a. a dark-staining body composed...Ch. 11 - The conversion of euchromatin into heterochromatin...Ch. 11 - What are the four key criteria that the genetic...Ch. 11 - A double-stranded DNA molecule contains 560...Ch. 11 - Prob. 3CQCh. 11 - Prob. 1COQCh. 11 - CoreSKILL How might you provide evidence that DNA...
Additional Science Textbook Solutions
Find more solutions based on key concepts
On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
Human Physiology: An Integrated Approach (8th Edition)
4.1 Write the symbols for the following elements.
a. copper
b. platinum
c. calcium
d. manganese
e. Iron
...
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
HUMAN ANATOMY
An obese 55-year-old woman consults her physician about minor chest pains during exercise. Explain the physicia...
Biology: Life on Earth with Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the ability to distinguish old and newly synthesized DNA strands enable Meselson and Stahl to verify that DNA replication is semiconservative?arrow_forwardProcess 1 is Choose... • and process 2 is Choose... If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is Choose...arrow_forwardBiologyarrow_forward
- Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t copy and paste from Google thank youarrow_forwardWould an experiment similar to that performed byHershey and Chase work if the basic design were appliedto the phenomenon of transformation? Explain why orwhy not.arrow_forwardDuring agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forward
- 3a please in simple languagearrow_forwardGriffith, in his 1928 experiments, demonstrated that bacterial strains could be genetically transformed. The evidence that DNA was the transforming principle responsible for this phenomenon came later. What was the key experiment that Avery, MacCleod, and McCarty performed to prove that DNA was responsible for the genetic change from rough cells into smooth cells? Pls help explain this question asap!!arrow_forwardCompare the accuracy of DNA replication, RNAsynthesis, and protein synthesis. Which mechanisms are used to ensure the fidelity of each of these processes?arrow_forward
- Protein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:arrow_forwardcould Nirenberg and Matthaei have substituted RNA polymerase instead of polynucleotide phosphorylase without otherwise modifying the experiment? Why or why not?arrow_forwardDuring dna electrophoresis what fragments migrate towards? Larve or small! Which charge slower than small fragments? Positive or negative?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license