
To describe:
The trait that appears to run in an individual’s family.
Introduction:
Any individual’s characters, behavior, and appearance are the expression of traits which organism contains. A trait can be made up of two similar allele and termed as homozygous, and the heterozygous allele made-up of two different allele.
To describe:
The trait runs in individual family because inheritance or the environmental factors that is common to family members.
Introduction:
Inheritance is the method by which the alleles get transferred along the generations. Inheritance is a sharing of characters between parents and their child.
To distinguish:
The possibilities that the trait runs in individual family because inheritance or the environmental factors that are common to family members.
Introduction:
An allele represents different form of a particular gene, present on chromosome. A gene is responsible for a trait and variation in that particular trait is shown by different alleles. The genotype is the genetic content of the organism which determines the phenotype. On a larger extent a phenotype is defined by genotype and environmental factor

Want to see the full answer?
Check out a sample textbook solution
Chapter 1 Solutions
Genetics: A Conceptual Approach 6E w/ SaplingPlus (Six-Month Access)
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





