Concept explainers
If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?
TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
a. | Two |
b. | Three |
c. | Four |
d. | Five |
![Check Mark](/static/check-mark.png)
Introduction:
Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.
Answer to Problem 1MCQ
Correct answer:
GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Option c. is given as, “Four.”
Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.
Reason for incorrect answer:
Option a. is given as, “Two.”
GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.
Option b. is given as, “Three.”
When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.
Option d. is given as, “Five.”
GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 11 Solutions
BIOLOGY THE ESSENTIALS CONNECT ONLY
- Identify the indicated tissue? (stem x.s.) parenchyma collenchyma sclerenchyma ○ xylem ○ phloem none of thesearrow_forwardWhere did this structure originate from? (Salix branch root) epidermis cortex endodermis pericycle vascular cylinderarrow_forwardIdentify the indicated tissue. (Tilia stem x.s.) parenchyma collenchyma sclerenchyma xylem phloem none of thesearrow_forward
- Identify the indicated structure. (Cucurbita stem l.s.) pit lenticel stomate tendril none of thesearrow_forwardIdentify the specific cell? (Zebrina leaf peel) vessel element sieve element companion cell tracheid guard cell subsidiary cell none of thesearrow_forwardWhat type of cells flank the opening on either side? (leaf x.s.) vessel elements sieve elements companion cells tracheids guard cells none of thesearrow_forward
- What specific cell is indicated. (Cucurbita stem I.s.) vessel element sieve element O companion cell tracheid guard cell none of thesearrow_forwardWhat specific cell is indicated? (Aristolochia stem x.s.) vessel element sieve element ○ companion cell O O O O O tracheid O guard cell none of thesearrow_forwardIdentify the tissue. parenchyma collenchyma sclerenchyma ○ xylem O phloem O none of thesearrow_forward
- Please answer q3arrow_forwardRespond to the following in a minimum of 175 words: How might CRISPR-Cas 9 be used in research or, eventually, therapeutically in patients? What are some potential ethical issues associated with using this technology? Do the advantages of using this technology outweigh the disadvantages (or vice versa)? Explain your position.arrow_forwardYou are studying the effect of directional selection on body height in three populations (graphs a, b, and c below). (a) What is the selection differential? Show your calculation. (2 pts) (b) Which population has the highest narrow sense heritability for height? Explain your answer. (2 pts) (c) If you examined the offspring in the next generation in each population, which population would have the highest mean height? Why? (2 pts) (a) Midoffspring height (average height of offspring) Short Short Short Short (c) Short (b) Short Tall Short Tall Short Short Tall Midparent height (average height of Mean of population = 65 inches Mean of breading parents = 70 inches Mean of population = 65 inches Mean of breading parents = 70 inches Mean of population = 65 inches Mean of breading parents = 70 inchesarrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305967359/9781305967359_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305112100/9781305112100_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)