Concept explainers
If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?
TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
a. | Two |
b. | Three |
c. | Four |
d. | Five |

Introduction:
Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.
Answer to Problem 1MCQ
Correct answer:
GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Option c. is given as, “Four.”
Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.
Reason for incorrect answer:
Option a. is given as, “Two.”
GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.
Option b. is given as, “Three.”
When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.
Option d. is given as, “Five.”
GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 11 Solutions
Connect with LearnSmart for Hoefnagels: Biology: The Essentials
- Ch.23 How is Salmonella able to cross from the intestines into the blood? A. it is so small that it can squeeze between intestinal cells B. it secretes a toxin that induces its uptake into intestinal epithelial cells C. it secretes enzymes that create perforations in the intestine D. it can get into the blood only if the bacteria are deposited directly there, that is, through a puncture — Which virus is associated with liver cancer? A. hepatitis A B. hepatitis B C. hepatitis C D. both hepatitis B and C — explain your answer thoroughlyarrow_forwardCh.21 What causes patients infected with the yellow fever virus to turn yellow (jaundice)? A. low blood pressure and anemia B. excess leukocytes C. alteration of skin pigments D. liver damage in final stage of disease — What is the advantage for malarial parasites to grow and replicate in red blood cells? A. able to spread quickly B. able to avoid immune detection C. low oxygen environment for growth D. cooler area of the body for growth — Which microbe does not live part of its lifecycle outside humans? A. Toxoplasma gondii B. Cytomegalovirus C. Francisella tularensis D. Plasmodium falciparum — explain your answer thoroughlyarrow_forwardCh.22 Streptococcus pneumoniae has a capsule to protect it from killing by alveolar macrophages, which kill bacteria by… A. cytokines B. antibodies C. complement D. phagocytosis — What fact about the influenza virus allows the dramatic antigenic shift that generates novel strains? A. very large size B. enveloped C. segmented genome D. over 100 genes — explain your answer thoroughlyarrow_forward
- What is this?arrow_forwardMolecular Biology A-C components of the question are corresponding to attached image labeled 1. D component of the question is corresponding to attached image labeled 2. For a eukaryotic mRNA, the sequences is as follows where AUGrepresents the start codon, the yellow is the Kozak sequence and (XXX) just represents any codonfor an amino acid (no stop codons here). G-cap and polyA tail are not shown A. How long is the peptide produced?B. What is the function (a sentence) of the UAA highlighted in blue?C. If the sequence highlighted in blue were changed from UAA to UAG, how would that affecttranslation? D. (1) The sequence highlighted in yellow above is moved to a new position indicated below. Howwould that affect translation? (2) How long would be the protein produced from this new mRNA? Thank youarrow_forwardMolecular Biology Question Explain why the cell doesn’t need 61 tRNAs (one for each codon). Please help. Thank youarrow_forward
- Molecular Biology You discover a disease causing mutation (indicated by the arrow) that alters splicing of its mRNA. This mutation (a base substitution in the splicing sequence) eliminates a 3’ splice site resulting in the inclusion of the second intron (I2) in the final mRNA. We are going to pretend that this intron is short having only 15 nucleotides (most introns are much longer so this is just to make things simple) with the following sequence shown below in bold. The ( ) indicate the reading frames in the exons; the included intron 2 sequences are in bold. A. Would you expected this change to be harmful? ExplainB. If you were to do gene therapy to fix this problem, briefly explain what type of gene therapy youwould use to correct this. Please help. Thank youarrow_forwardMolecular Biology Question Please help. Thank you Explain what is meant by the term “defective virus.” Explain how a defective virus is able to replicate.arrow_forwardMolecular Biology Explain why changing the codon GGG to GGA should not be harmful. Please help . Thank youarrow_forward
- Stage Percent Time in Hours Interphase .60 14.4 Prophase .20 4.8 Metaphase .10 2.4 Anaphase .06 1.44 Telophase .03 .72 Cytukinesis .01 .24 Can you summarize the results in the chart and explain which phases are faster and why the slower ones are slow?arrow_forwardCan you circle a cell in the different stages of mitosis? 1.prophase 2.metaphase 3.anaphase 4.telophase 5.cytokinesisarrow_forwardWhich microbe does not live part of its lifecycle outside humans? A. Toxoplasma gondii B. Cytomegalovirus C. Francisella tularensis D. Plasmodium falciparum explain your answer thoroughly.arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





