If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC a. Two b. Three c. Four d. Five

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOLOGY, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

4. This question focuses on entrainment. a. What is entrainment? b. What environmental cues are involved in entrainment, and which one is most influential? c. Why is entrainment necessary? d. Assuming that a flash of darkness is an effective zeitgeber, what impact on circadian rhythms would you expect to result from an event such as the 2024 solar eclipse (assume it was viewed from Carbondale IL, where totality occurred at about 2 pm)? Explain your reasoning. You may wish to consult this phase response diagram. Phase Shift (Hours) Delay Zone Advance Zone Dawn Mid-day Dusk Night Dawn Time of Light Stimulus e. Finally, give a real-world example of how knowledge of circadian rhythms and entrainment has implications for human health and wellbeing or conservation biology. This example could be from your reading or from things discussed in class.

Generate one question that requires a Punnet Squre to solve the question. Then show how you calculate the possibilities of genotype and phenotype

Briefly state the physical meaning of the electrocapillary equation (Lippman equation).

Answer 2

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOLOGY, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOLOGY, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOLOGY, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOLOGY, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Answer 8

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOLOGY, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer 12

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Answer 13

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOLOGY, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Answer 14

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.