If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC a. Two b. Three c. Four d. Five

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

Biology: Concepts and Investigations, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

You aim to test the hypothesis that the Tbx4 and Tbx5 genes inhibit each other's expression during limb development. With access to chicken embryos and viruses capable of overexpressing Tbx4 and Tbx5, describe an experiment to investigate whether these genes suppress each other's expression in the limb buds. What results would you expect if they do repress each other? What results would you expect if they do not repress each other?

You decide to delete Fgf4 and Fgf8 specifically in the limb bud. Explain why you would not knock out these genes in the entire embryo instead.

You implant an FGF10-coated bead into the anterior flank of a chicken embryo, directly below the level of the wing bud. What is the phenotype of the resulting ectopic limb? Briefly describe the expected expression domains of 1) Shh, 2) Tbx4, and 3) Tbx5 in the resulting ectopic limb bud.

Answer 2

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

Biology: Concepts and Investigations, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

Biology: Concepts and Investigations, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

Biology: Concepts and Investigations, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

Biology: Concepts and Investigations, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Answer 8

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

Biology: Concepts and Investigations, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer 12

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Answer 13

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

Biology: Concepts and Investigations, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Answer 14

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.