
MICROBIOLOGY-MASTERING MICRO.-ACCESS
11th Edition
ISBN: 9780321802705
Author: Tortora
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 11, Problem 10MCQ
Summary Introduction
Introduction:
Cyanobacteria are prokaryotic bacteria which belongs to Eubacteria kingdom. Cyanophyta is a phylum which produced energy through photosynthesis. It is a gram negative bacteria produce characteristic pigment gives blue green coloration.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 11 Solutions
MICROBIOLOGY-MASTERING MICRO.-ACCESS
Ch. 11 - The following outline can be used to identify...Ch. 11 - Compare and contrast each of the following: a....Ch. 11 - DRAW IT Draw a key to differentiate the following...Ch. 11 - Prob. 4RCh. 11 - If you Gram-stained the bacteria that live in the...Ch. 11 - Which of the following does not belong with the...Ch. 11 - Prob. 3MCQCh. 11 - Prob. 4MCQCh. 11 - Which of the following terms is the most specific?...Ch. 11 - Which one of the following does not belong with...
Ch. 11 - Which of the following pairs is mismatched? a....Ch. 11 - Prob. 8MCQCh. 11 - When Legionella was newly discovered, why was it...Ch. 11 - Prob. 10MCQCh. 11 - Prob. 1ACh. 11 - Prob. 2ACh. 11 - Bacteria are single-celled organisms that must...Ch. 11 - After contact with a patients spinal fluid, a lab...Ch. 11 - Between April 1 and May 15 of one year. 22...Ch. 11 - Prob. 3CAE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College


Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Metabolism and ATP; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-6VyMFQ7rRo;License: Standard YouTube License, CC-BY
Metabolic Diversity (photo-/chemo-, auto-/hetero-, litho-/organo-trophy) | GEO GIRL; Author: GEO GIRL;https://www.youtube.com/watch?v=vyLAm1CYIsI;License: Standard YouTube License, CC-BY