Campbell Biology (10th Edition)
10th Edition
ISBN: 9780321775658
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10.2, Problem 1CC
What color of light is least effective in driving photosynthesis? Explain.
Expert Solution & Answer
Learn your wayIncludes step-by-step video
schedule01:59
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 10 Solutions
Campbell Biology (10th Edition)
Ch. 10.1 - Prob. 1CCCh. 10.1 - Explain how the use of an oxygen isotope helped...Ch. 10.1 - WHAT IF? The Calvin cycle requires ATP and NADPH,...Ch. 10.2 - What color of light is least effective in driving...Ch. 10.2 - In the light reactions, what is the initial...Ch. 10.2 - Prob. 3CCCh. 10.3 - To synthesize one glucose molecule, the Calvin...Ch. 10.3 - How are the large numbers of ATP and NADPH...Ch. 10.3 - Prob. 3CCCh. 10.3 - DRAW IT Redraw the cycle in Figure 10.19 using...
Ch. 10.3 - Prob. 5CCCh. 10.4 - Describe how photorespiration lowers...Ch. 10.4 - The presence of only PS I, not PS II, in the...Ch. 10.4 - MAKE CONNECTIONS Refer to the discussion of ocean...Ch. 10.4 - WHAT IF? How would you expect the relative...Ch. 10 - Compare the roles of CO2 and H2O in cellular...Ch. 10 - The absorption spectrum of chlorophyll a differs...Ch. 10 - Prob. 10.3CRCh. 10 - Why are C4 and CAM photosynthesis more...Ch. 10 - The light reactions of photosynthesis supply the...Ch. 10 - Which of the following sequences correctly...Ch. 10 - How is photosynthesis similar in C4 plants and CAM...Ch. 10 - Prob. 4TYUCh. 10 - Prob. 5TYUCh. 10 - In mechanism, photophosphorylation is most similar...Ch. 10 - Prob. 7TYUCh. 10 - Prob. 8TYUCh. 10 - EVOLUTION CONNECTION Photorespiration can decrease...Ch. 10 - SCIENTIFIC INQUIRY MAKE CONNECTIONS The following...Ch. 10 - WRITE ABOUT A THEME: ENERGY AND MATTER Life is...Ch. 10 - SYNTHESIZE YOUR KNOWLEDGE Watennelon snow in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
2. Whether an allele is dominant or recessive depends on
a. how common the allele is, relative to other alleles...
Campbell Biology: Concepts & Connections (9th Edition)
Q1. Which wavelength of light has the highest frequency?
a) 10 nm
b) 10 mm
c) 1 nm
d) 1 mm
Chemistry: A Molecular Approach (4th Edition)
Match each of the following items with all the terms it applies to:
Human Physiology: An Integrated Approach (8th Edition)
1.3 Obtain a bottle of multivitamins and read the list of ingredients. What are four chemicals from the list?
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Use the following graph to answer questions 3 and 4. 3. Which of the lines best depicts the log phase of a ther...
Microbiology: An Introduction
Two culture media were inoculated with four different bacteria. After incubation, the following results were ob...
Microbiology: An Introduction
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Photosynthesis & Respiration | Reactions | Chemistry | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=3XIyweZg6Sw;License: Standard YouTube License, CC-BY