WHAT IS LIFE? A GUIDE TO BIOLOGY W/PHYS.
5th Edition
ISBN: 9781319446581
Author: PHELAN
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 10, Problem 2MC
Summary Introduction
Introduction:
Mutations are minute changes in the DNA sequence of a gene that can bring about significant variations.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following is NOT true about mutations?
A. Mutations can be harmful but not beneficial to the cell
B. Nucleotide substitution in DNA can cause nonsense mutations
C. Nucleotide substitution in DNA can cause missense mutations
D. Mutagens increase the rate of mutation, but mutations are still random
E. Nucleotide insertion or deletion in DNA can cause frameshift mutations
Which statement(s) below regarding DNA mutations is true:
A. Mutations only occur in genes
B. Mutations always result in phenotypic alterations
C. Mutations are only induced by extrinsic (environmental) factors
D. Mutations can occur in promoters
E. Point mutations can be caused by transposons or “jumping genes”
5) Mutations that confer no apparent selective advantage or disadvantage in a particular environment are said to be
a.These types of mutations cannot be classified.
b.stabilizing
c.non-functional
d.deleterious
e.selectively neutral
Chapter 10 Solutions
WHAT IS LIFE? A GUIDE TO BIOLOGY W/PHYS.
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following terms refer to the case when a mutation results in a significant decrease or a complete loss of the functional activity of a gene product? a. gain-of-function mutation b. loss-of-function mutationarrow_forwardWhich of the following types of mutations will have the most devastating effect on a cell?A.frameshift mutationB. missense mutationC. nonsense mutationD. silent mutationarrow_forwardWhen using gene therapy to treat an hereditary disease, the idea is to: A. Introduce the correct gene into the patient's DNA B. Inject the patient with a specific protein to cure the disease. C. Blood transfusions from healthy individuals. D. ntroduce mRNA molecules with the correct genetic information to the patient. E. Introduce a virus to the patient that will specifically destroy mutated cells.arrow_forward
- Which of the following statements best describes the effect of mutations in DNA? A Mutations result in changes that can be positive, be negative, or have no consequences B Mutations result in changes that always have negative consequences C Mutations result in changes that cannot be detected unless it is revealed by genetic screening D Mutations result in changes that have no consequencesarrow_forwardA student reads that deer mice that migrated to the hills of Nebraska originally had dark colored coats. Over many years, due to a mutation, the coat color of the mice changed to a lighter color to blend in easily with the sand. Which argument summarizes the mutation in deer mice? O Itis a harmful mutation as it caused a change in the original coat color of mice. O It is a beneficial mutation as it helped the mice survive in their new surroundings. O It is a neutral mutation as the change in coat color did not affect any body functions in the mice, and only helped the survival of the deer mice living in Nebraska. O Itis a neutral mutation as only the deer mice living in Nebraska were affected, and all other populations were unaffected. hp 女 -> Ce esc & % 8 3 4arrow_forwardWhich of the following is an example of a somatic mutation? a. A mutation in an embryonic muscle cell b. A mutation in a sperm cell c. A mutation in an adult nerve cell The somatic cells are all cells of the body excluding the d. Both a and c are examples of somatic mutations.arrow_forward
- In your own words, describe which type of mutation causes a greater change in the phenotype of an organism: insertions and deletions or point mutations.arrow_forwardDNA methylation is A. heritable and generally activates gene expression. B. heritable and generally represses gene expression. C. not heritable and generally represses gene expression. D. not heritable and generally activates gene expression.arrow_forwardA mutation in a coding region of DNA, but that does not change the amino acid, would almostcertainly be considered a(n) ____________ allele.And this kind of mutation is also called ___________ .b. Most nonsense mutations would create __________ alleles.However, describe a situation in which a nonsense mutation would create an isomoprh allele.c. A missense mutation will usually create a(n) _________ allele.However, describe a situation in which a missense mutation would create a neomorph allele.arrow_forward
- Which of the following statament is NOT TRUE about gene expression?a. The expression of genes that code for proteins includes two stages: replication and translationb. Translation is the synthesis of a polypeptide using the information in the mRNA.c. During gene expression, the information encoded in genes is used to make specific polypeptide chains or RNA molecules.d. Gene expression is the process by which DNA directs the synthesis of proteinsarrow_forwardWhich of the following statements is true about the effects of mutations in somatic cells and gametes? A. Only mutations in gametes can affect future generations. B. Only mutations in somatic cells can affect future generations. C. Neither mutations in somatic cells or gametes can affect future generations. D. Mutations in both somatic cells and gametes can affect future generations.arrow_forwardOf those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY