
Concept explainers
A muscle that assists an agonist by causing a like movement or by stabilizing a joint over which an agonist acts is a(n)
(a) antagonist, (b) prime mover, (c) synergist, (d) agonist.

To determine:
The type of muscle that assists an agonist either by causing a like movement or by providing the stability to the joint on which agonist acts upon is:
Antagonist
Prime mover
Synergist
Agonist
Answer to Problem 1MC
Correct answer:
(c) Synergist: The term “synergist” refers to the working together of two or more components. Similarly, the combined effect thus generated is referred to as the synergistic effect.
Explanation of Solution
Explanation for the correct answer:
An agonist is a muscle that is responsible for generating a specific movement. It might also be referred to as the prime mover, for example, the pectoralis muscle. Synergists help the agonist or the prime mover in completing its movement by aiding a small amount of force or avoiding the movements that are not necessary. Thus option (c) is considered as a correct answer.
Explanation for the incorrect answers:
Option (a) is given as antagonist. Antagonistic muscle is defined as the muscle that opposes the action of another muscle. Example: biceps and triceps. Thus this option is considered as an incorrect answer.
Option (b) is given as prime mover. Prime mover is defined as the muscle that is primarily responsible for the generation or control of a specific movement. Example: pectoralis major muscle is a prime mover of arm flexion. Thus this option is considered as an incorrect answer.
Option (d) is given as agonist. Agonist or Prime mover are the words used interchangeably for the muscle that is primarily responsible for producing a specific movement. Thus this option is considered as an incorrect answer.
Hence, option (a), (b) and (d) are considered as incorrect options.
Thus, it is concluded that synergist is a muscle that help the prime mover in completing its movement by aiding a small amount of force or avoiding the movements that are not necessary.
Want to see more full solutions like this?
Chapter 10 Solutions
Anatomy & Physiology (6th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage


