Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
5th Edition
ISBN: 9780135891018
Author: ROBERT BAUMAN
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 1, Problem 3CT
Haemophilus influenzae does not cause flu, but it received its name because it was once thought to be the cause. Explain how a proper application of Koch’s postulates would have prevented this error in nomenclature.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What genus was the organism that spread through the NIH hospital in bethesda, maryland?
pneumoniae
stenotrophomonas
staphylococcus
klebsiella
Using the Koch's Postulates, support the findings
that Mycobacterium tuberculosis is the causative
agent of tuberculosis. Specifically, you have to
provide brief narratives/pictures/proofs and
sources that support the postulate listed below:
The organism must be isolated from the newly
infected animals and cultured again in the
laboratory, after which it should be seen to be
the same as the original organism.
A. What is Pasteur’s “Germ Theory of Disease?. How did he discover this principle? B. What major obstacle did he have to overcome (A philosophical concept) to establish the validity of the theory.
Chapter 1 Solutions
Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
Ch. 1 - Some people consider Leeuwenhoek the Father of...Ch. 1 - Prob. 1CCSCh. 1 - Some people consider Pasteur or Koch to be the...Ch. 1 - Variant Creutzfeldt-Jakob Disease Ellen screamed...Ch. 1 - Prob. 3TMWCh. 1 - Which of the following microorganisms are not...Ch. 1 - Prob. 2MCCh. 1 - In which habitat would you most likely find...Ch. 1 - Of the following scientists, who first promulgated...Ch. 1 - Which of the following scientists hypothesized...
Ch. 1 - Prob. 6MCCh. 1 - Prob. 7MCCh. 1 - Prob. 8MCCh. 1 - A scientist who studies the role of microorganisms...Ch. 1 - The laboratory of Robert Koch contributed which of...Ch. 1 - Fill in the Blanks 1. Environmental microbiology...Ch. 1 - Prob. 2FIBCh. 1 - Fill in the Blanks 3. Chemotherapy _______________Ch. 1 - Fill in the Blanks 4. Immunology _______________Ch. 1 - Fill in the Blanks 5. Infection control...Ch. 1 - Fill in the Blanks 6. Etiology _______________Ch. 1 - Fill in the Blanks 7. Epidemiology _______________Ch. 1 - Fill in the Blanks 8. Biotechnology...Ch. 1 - Fill in the Blanks 9. Food microbiology...Ch. 1 - Why was the theory of spontaneous generation a...Ch. 1 - Discuss the significant difference between the...Ch. 1 - List six types of microorganisms.Ch. 1 - Defend this statement: The investigations of...Ch. 1 - Why would a macroscopic tapeworm be studied in...Ch. 1 - Describe what has been called the Golden Age of...Ch. 1 - List four major questions that drive...Ch. 1 - Refer to the four steps in the scientific method...Ch. 1 - Prob. 9SACh. 1 - What does the term HAI (nosocomial infection) have...Ch. 1 - Match each of the following descriptions with the...Ch. 1 - Prob. 1VICh. 1 - Show where microbes ended up in Pasteurs...Ch. 1 - If Robert Koch had become interested in a viral...Ch. 1 - In 1911, the Polish scientist Casimir Funk...Ch. 1 - Haemophilus influenzae does not cause flu, but it...Ch. 1 - Just before winter break in early December, your...Ch. 1 - Design an experiment to prove that microbes do not...Ch. 1 - Prob. 6CTCh. 1 - Compare and contrast the investigations of Redi,...Ch. 1 - If you were a career counselor directing a student...Ch. 1 - A few bacteria produce disease because they derive...Ch. 1 - How might the debate over spontaneous generation...Ch. 1 - French microbiologists, led by Pasteur, tried to...Ch. 1 - Why arent Kochs postulates always useful in...Ch. 1 - Albert Kluyver said, From elephant to ......Ch. 1 - The ability of farmers around the world to produce...Ch. 1 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What was the significance of the accidental re-inoculation of some chickens that Pasteur had previously exposed to the bacteria that causees cholera? Why do you think these chickens did not die after the first exposure to this bacterium?arrow_forwardCapsules are virulence factors (responsible for pathogenicity). Name two bacteria that are capsulated and pathogenic.arrow_forwardName the element which caused minamatta disease in Japan.arrow_forward
- Choose the false statement: (Regarding Pasteur’s famous experiment) The swan necked flasks were important because they allowed the broth to remain sterile, while still remaining open to the atmosphere. Pasteur’s work with the swan neck flasks was only of importance to the food industry; his work occurred long before anyone, including Pasteur, had any awareness that diseases could be caused by microscopic agents. The swan necked flasks were used to prove that life could only arise from pre-existing cells.arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forwardCharacterize and give a brief description of the following bacteria: Pseudomonas Salmonella typhiarrow_forward
- A student argues that it makes no sense to be concerned about coliforms in drinking water because they are harmless members of our normal microbiota. Explain why regulatory agencies are concerned about coliforms.arrow_forwardAerobic Salmonella enterica and some of the Gram-negative rods E. coli, share some of the classic microbiological features. Which taxonomy classification approach can you use to differentiate the two genera? Explain this approach.arrow_forwardTwo microbiologists are writing a textbook, but they cannot agree where to place the discussion of botulism. One favored the chapter on nervous system infections, whereas the other insisted on the chapter covering digestive system infections. Where do you think the discussion should be placed, and why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License