Concept explainers
Which of the following is not a core concept of biology, as advocated by “Vision and Change”?
- a. Evolution
- b. Information flow, exchange, and storage
- c. Structure and function
- d. Taxonomy
- e. Pathways and transformation of energy and matter

Introduction: A conference was held by “The American Association for the Advancement of Science”. This conference was known as “Vision and change”. The aim of this conference was to enhance education in the field of biology. This resulted in the reorganization of essential biological theories.
Answer to Problem 1TY
Correct answer: Taxonomy is not a core concept of biology, as advocated by “Vision and Change”. Hence, the correct answer is option d.
Explanation of Solution
Reason for correct answer:
The conference named “Vision and Change” includes five major biological theories. These theories are regarded as the core concepts in the field of biology. These theories include:
- Evolution
- Structure and functions of living organisms.
- Information flow, storage, and exchange.
- Pathways that are required for energy and matter transfer
- Living systems
Taxonomy is not a core concept of biology according to “Vision and Change”.
Option d. is given as “Taxonomy”.
Taxonomy is not included in the five biological theories given by “Vision and Change”. Hence, the correct answer is option d.
Reasons for incorrect answer:
Option a. is given as, “Evolution”.
Evolution is the process of the development of an organism from its forefather. According to “Vision and Change”, it is an important concept of biology. Hence, option a. is incorrect.
Option b. is given as, “Information flow, exchange, and storage”.
Information flow, exchange, and storage are among the five concepts of biology. Hence, option b. is incorrect.
Option c. is given as, “Structure and function”.
Structure and function are important in living organisms. Every organism has a unique structure and function that makes it different from the rest. “Vision and Change” has included structure and function among the five core concepts. Hence, option c. is incorrect.
Option e. is given as, “Pathways and transformation of energy and matter”.
Pathways and transformation of energy and matter have been included in the concepts given by “Vision and Change”. Hence, option e. is incorrect.
Hence, the options a., b., c., and e. are incorrect.
Therefore, taxonomy has not been included as a core concept in the field of biology by “Vision and Change”. This conference recognized only five processes as “the core concepts of biology”.
Want to see more full solutions like this?
Chapter 1 Solutions
Biology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning





