
Concept explainers
History may not be your favorite subject, especially learning about a bunch of long-dead scientists who made discoveries that we now take for granted. With an open mind, you may actually find the information interesting and learn a few things you didn’t know before.
During your examination of the topics in this chapter, consider the following:
Which pioneers of

To list: The pioneers of microbiology who had the leading impact on surgical patient care.
Introduction: The discoveries and inventions in the field of microbiology are vital in the present world. They were fundamental when familiarized to the public as well as to academia. The study of microorganisms is highly required in the field of surgery.
Explanation of Solution
Numerous pioneers of microbiology have set forth various techniques and procedures in the field of surgical patient care. Some of them are as follows:
- Louis Pasteur is a French scientist well-known for his work on pasteurization. He classified the microbes into two broad categories, namely aerobes and anaerobes.
- Joseph Lister is a British surgeon, and he is the first person to describe the aseptic techniques required in the operating rooms. He illustrated the best use of phenol on the hands, wounds, equipment, and during the surgical protocol.
- Edward Jenner is well known for his work on vaccine development. He made attempts to induce immunity against smallpox virus in a child with pustules of cowpox.
- Ignaz Semmelweis is a physician from Hungary who found out that washing the hands with antimicrobial solutions decreases the risk of cross-contamination.
- Robert Koch is a clinician who belongs to Germany, and he conducted an experiment using the anthrax bacteria in cattle and formulated a few postulates. These postulates were later referred to as Koch Postulates.
All these inventions and discoveries are inevitable to the surgical patient care and other fields of biology.
Want to see more full solutions like this?
Chapter 1 Solutions
Microbiology for Surgical Technologists (MindTap Course List)
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengagePrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:CengageHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning


