a.
To complete: The blanks using the descriptive terminology.
Introduction: The scientific study related to non-human and human body movement is known as
a.

Answer to Problem 1RQ
Correct answer: The sternum is anterior to the vertebral column.
Explanation of Solution
The sternum is also known as the breastbone. It is a long flat bone present in the center part of the chest. It basically forms the front part of the rib cage that connects the ribs through cartilage. It mainly protects the lungs, major blood vessels, and injury in the heart, which is found anterior to the vertebral column.
b.
To complete: The blanks using the descriptive terminology.
b.

Answer to Problem 1RQ
Correct answer: The calcaneus is on the posterior portion of the foot.
Explanation of Solution
In humans, the heel bone is known as the calcaneus. It is the foot tarsus bone that forms the heel part of the body. The calcaneus bone is found in the posterior part on the portion of the foot.
c.
To complete: The blanks using the descriptive terminology.
c.

Answer to Problem 1RQ
Correct answer: The hip is inferior to the chest.
Explanation of Solution
The hip region is located anterior and lateral to the gluteal region and inferior to the iliac crest. There are three pelvic bones that fuse to form the hip bone known as the acetabulum. The hip bone is found inferior in the chest region.
d.
To complete: The blanks using the descriptive terminology.
d.

Answer to Problem 1RQ
Correct answer: The femur is proximal to the tibia.
Explanation of Solution
The femur bone is also known as the thigh bone that is considered as the strongest bone in the body. This bone is involved in the jumping, walking, and sitting activities. The femur comprises two epiphyses and one diaphysis. The location of the femur is found proximal to the tibia.
e.
To complete: The blanks using the descriptive terminology.
e.

Answer to Problem 1RQ
Correct answer: The radius is on the lateral side of the forearm.
Explanation of Solution
One of the two large bones of the forearm is basically known as the radius. The radius takes part in two major joints; the wrist joint and the elbow joint. The radius is present lateral to the forearm.
Want to see more full solutions like this?
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





