You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides? Multiple Choice
Q: 5. As you know, the lac promoter is a poor intrinsic promoter: it is transcribed efficiently only…
A: Q 5.) Ans.The given question explores the lac operon's regulation in E. coli through mutagenesis and…
Q: Some aggressive understory ant species patrol the foliage of the tropical forest shrub Psychotria…
A: Psychotria limonensis is a well-known shrub found in the understory of tropical rainforests…
Q: What is the difference and rolls of humoral and cell-mediated immunity? what is the adaptve immune…
A: The immune system employs two crucial branches, humoral and cell-mediated immunity, as part of its…
Q: Cytokines affect only T or B lymphocytes. Select one: True O False
A: Through the mediation of cytokines, immune cells communicate with one another and coordinate their…
Q: drugs
A: 1. Metformin:Side Effects/Adverse Effects: Common side effects include gastrointestinal issues like…
Q: Name components used by a T-even virus to lyse the host cell.
A: The T-even virus refers to a family of bacteriophages, which are viruses that infect and replicate…
Q: Your class is studying the burrs – the seed pods – of the common burdock plant. Your lab partner…
A: The genus Arctium is commonly known as burdock plant. It is a biennial plant and has a height of 3…
Q: An organism has two chromosomes only. Chromosome 1 has its centromere near one end and carries the…
A: Metaphase of Meiosis IHomologous chromosomes are paired up and aligned along the equator of the…
Q: Biome Tropical Rainforest Temperate Deciduous Forest Boreal Forest (Taiga) Temperate Grassland…
A: It is a biogeographical unit that is classified based on the species that live in the location. It…
Q: Both the yeast Saccharomyces cerevisiae and the bacterium Zymomonas mobilis produce ethanol from…
A: The production of ethanol through fermentation has gained significant attention due to its potential…
Q: 1. 3 DTO O 오마 e. A male carrier PTO 0 이마 9 a. A female carrier b. A male who is affected with the…
A: A pedigree is a graphical depiction of a family's genetic history or genealogy used to examine the…
Q: Your adorable 5-pound puppy eventually becomes a 70-lb black lab that still wants to sit on your…
A: There are many differences between living and nonliving. Certain points or characteristics conform…
Q: Telomerase contains both _______________ and _________________. Question 14 options: RNA and…
A: Telomerase is an enzyme that plays a vital role in preserving the integrity and stability of the…
Q: Use the measurement tool to measure the zone of inhibition for each antibiotic sample in millimeters…
A: Antibiotic zone of inhibitionAntibiotics are the compounds or substances that kill or inhibit the…
Q: Routine and additional mammographic projection of male and female breast
A: Both men and women can benefit from mammography for early identification and screening of breast…
Q: One of the most common heart conditions in the United States is valvular disease. Diseased valves…
A: In the human heart multiple valves are present that help unidirectional flow of blood. The main…
Q: 57) Which of the following is an example of bioremediation? A) bulldozing the land around an…
A: Bioremediation is the process of removing, degrading, or neutralising pollutants from contaminated…
Q: The image above (i.e., Figure A in the supplemental file) depicts which type of evolutionary event?…
A: Cladogenesis and anagenesis are two essential evolutionary biology processes that play critical…
Q: You are sitting in Biology class and a classmate asks you to help them understand the process of…
A: Translation is the process by which a polypeptide or a amino acid sequence is synthesized using mRNA…
Q: 3. If combinatorial control was not used in a human genome, with a size of 3B bp, how many…
A: In this context, we explore the potential number of transcriptional binding sites, including…
Q: Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables,…
A: This question is completely based on the transcription and translation processes. Transcription is…
Q: are control groups still used in today's medical research?
A: In clinical studies, the control group is crucial because they act as a benchmark for assessing the…
Q: Humans O c. Chimpanzees and Bonobos O d. Bonobos and Gorillas O e. Humans and Orangutans Chimpanzees…
A: A cladogram is a diagrammatic representation used in evolutionary studies to compare the…
Q: Describe what process leads to gene conversion. What are the consequences of gene conversion for…
A: Gene conversion is the process by which one DNA sequence replaces a homologous sequence such that…
Q: What structure, found at either end of eukaryotic chromosomes, protects DNA from exonucleases?…
A: Individual parts of the cell structure each have a distinct purpose that is necessary to carry out…
Q: Explain how the DNA code is used to create a protein
A: The process of creating proteins from the DNA code involves two essential steps: Transcription and…
Q: 1 2 Male Reproductive System 5 6 7 Endometrial tissue is typically only found in which structure…
A: Endometrial tissue is the innermost lining of the uterus, It consists of two regions - an epithelial…
Q: There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence…
A: Mutation is any sudden change in the sequence of nucleotides in a gene or change in the structure of…
Q: 41) For the successful development of a vaccine to be used against a pathogen, it is necessary that…
A: Immunity is an organism's ability to resist and protect itself from potential threats such as…
Q: In digestion, our accessory organs include: (SELECT ALL THAT APPLY) Liver Esophagus Pancreas…
A: The process of digestion is a complex and fascinating journey that our bodies undergo every time we…
Q: I just did an acute toxicity experiment using treated and non-treated effluents with daphnia magna…
A: If the mortality rate was higher in the treated effluent group compared to the non-treated effluent…
Q: Explain in your own words what the statement "mutations occur randomly" means
A: The statement "mutations occur randomly" implies that mutations, which are alterations in the…
Q: phosphodiester bonds 8 0-2-0-3 O HCS H₂C 8-6-0 H₂C OH O 0-6-0 H₂C OH O 2 purine pyrimidine T Strand…
A: DNA (Deoxyribonucleic Acid) is a double-stranded structure that carries the genetic instructions of…
Q: What type of DNA damage results from UV radiation? Name two pathways a cell might use to repair UV…
A: UV DNA damage refers to the formation of pyrimidine dimers in DNA caused by exposure to ultraviolet…
Q: An ebony strain of flies was discovered to be sensitive to carbon dioxide. Crossing a female…
A: A reciprocal cross is a breeding experiment used in genetics to determine the impact of parental sex…
Q: Give typing answer with explanation and conclusion What is the difference between a gene and a…
A: Genome refers to the entire genetic material of the cell which can be DNA or RNA. It may consist of…
Q: When discussing next-generation sequencing technologies: Question 19 options: The reads are…
A: Next-generation sequencing technologies are a group of methods that enable high-throughput and…
Q: Which of the 4 competition isoclines shown above indicates a stable coexistence? Case 1 N₁ '1 K₂ &…
A: is the competition coefficient. If in a area species 2 is introduced then competition is experienced…
Q: Differentiation of B cells into Ab-producing plasma cells occurs in the: a) Lymph nodes b) Spleen c)…
A: B cells or B lymphocytes, which are produced from bursae, are important components of the adaptive…
Q: Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and…
A: DNA (Deoxyribonucleic Acid):DNA is a molecule that contains the genetic instructions necessary for…
Q: 1. What would be the probability of an allele going to fixation after one generation of drift in a…
A: The Wright-Fisher model examines the alteration in frequencies of two alleles at a single diploid…
Q: There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence…
A: The five mutations are listed below---
Q: present in the mitochondrial genome.
A: Mitochondria is called the powerhouse of the cell. It is a unique organelle along with chloroplast…
Q: Which condition is MOST consistent with the given urinalysis results? Explain/Defend your answers by…
A: This analysis aims to identify the most likely condition based on the provided urinalysis results.…
Q: In incomplete dominance inheritance, a snapdragon plant that is homozygous for red flowers is…
A: Incomplete dominance is a type of inheritance pattern in genetics where the heterozygous phenotype…
Q: Please read the scenario below, and then answer the question (in bold) that follows. Tay-Sachs…
A: Tay-Sachs disease is a rare and fatal genetic disorder. It is an autosomal recessive condition…
Q: y is an internal location for gas exchange tissues advantageous for terrestrial animals?
A: An internal location for gas exchange tissues, such as the lungs in terrestrial animals, offers…
Q: Hyperglycemia TERM gastrectomy osteitis electroencephalogram diagnosis hy-per-gly-ce-mia excess of…
A: Cell is the basic structural and functional unit life. All living organisms are made up of cells. A…
Q: Nerve impulses are sent bidirectionally. True O False
A: A nerve impulse, also known as an action potential, is a brief electrical signal that travels along…
Q: In some eukaryote organisms, myocytes are a type of stem cell that become Muscle cells. These cells…
A: The cell is the smallest, basic functional unit of life that is capable of independent existence.…
Bio
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Shown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. = exons Transcription termination site (also poly A site) = introns Promoter Start of transcription 3' 5'. TAA ATG 50 TAC 130 222 850 126 132 90 ATT 5' 3 QUESTION 3: What is the length in nucleotides of the mature, processed B-globin mRNA? A.620 B.980 C.438 D.1600
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.A portion of the coding sequence of a cloned gene is shown here:5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄This portion of the gene encodes a polypeptide with the aminoacid sequence alanine–proline–aspartic acid–leucine–histidine–histidine–tyrosine–glycine–aspartic acid. Using the method ofsite- directed mutagenesis, a researcher wants to change the leucinecodon into an arginine codon, using an oligonucleotide that is19 nucleotides long. What is the sequence of the oligonucleotidethat should be used? Designate the 5′ and 3′ ends of the oligonucleotidein your answer. Note: The mismatch should be in the middleof the oligonucleotide, and a 1-base mismatch is preferableover a 2- or 3-base mismatch. Use the bottom strand as the templatestrand for this site-directed mutagenesis experiment.The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved. Bisulfite was treated ribosomes. The bisulfite was subsequently removed, and the amount of protein produced was determined using a translation assay. Why do you think we need a DMSO treated control group instead of a group not treated with anything?
- Where do you predict the N- and C-termini are located for Max? Match the words in the left column to the appropriate blanks in the sentences on the right. electrostatic dispersion negative C-terminus positive positively negatively N-terminus The Reset Help is interacting with the DNA. The first reason for this is because the a-amino group is positively charged and will interact favorably with the of the charge on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNAShown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. Question 6: How many amino acids are present in the wild-type human B-globin protein? = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription 3' 5' ATG 50 TẠC TAA 126 132 |ATT 90 130 222 850 3 5' Start codon Stop codon А. 438 В. 146 C. 620 D. 206 © 2013 John Wiley & Sons, Inc. All rights reserved.As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain