Homework Help is Here – Start Your Trial Now!
Science
Biology
You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present.. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of mRNA produced from the DNA. If you were to do this test and the level of mRNA for the muscle specific gene were higher than the level of mRNA for the glowing gene, describe one potential difference between these two genes that might account for a different amount of mRNA. Remember there are no mutations and they have the same promoter and promoter proximal regions. There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect mRNA quantity and you must describe how it would affect quantity.

You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present.. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of mRNA produced from the DNA. If you were to do this test and the level of mRNA for the muscle specific gene were higher than the level of mRNA for the glowing gene, describe one potential difference between these two genes that might account for a different amount of mRNA. Remember there are no mutations and they have the same promoter and promoter proximal regions. There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect mRNA quantity and you must describe how it would affect quantity.

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
Help!
You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of mRNA produced from the DNA. If you were to do this test and the level MRNA for the muscle specific gene were higher than the level of mRNA for the glowing gene, describe one potential difference between these two genes that might account for a different amount of mRNA. Remember there are no mutations and they have the same promoter and promoter proximal regions. There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect mRNA quantity and you must describe how it would affect quantity. Please answer in a complete sentence.
Transcribed Image Text:You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of mRNA produced from the DNA. If you were to do this test and the level MRNA for the muscle specific gene were higher than the level of mRNA for the glowing gene, describe one potential difference between these two genes that might account for a different amount of mRNA. Remember there are no mutations and they have the same promoter and promoter proximal regions. There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect mRNA quantity and you must describe how it would affect quantity. Please answer in a complete sentence.
You are a scientist studying muscle cells. You are interested in making all of the muscle cells of a worm glow green. You have identified a muscle specific protein that is expressed in all muscle cells of the worm. You have also found a protein in jelly fish that glows green. You take all of the DNA from the glowing jelly fish gene between the +1 site and transcription termination, and par it with the promoter from the muscle gene from worms. You then take this new construct (shown below) and insert it into the genome of your worms using a virus. This virus inserts the DNA in a random place in the genome. MUSCLE PROMOTER GLOWING GENE FROM JELLY FISH 5 AGCATGAGAG ACATATATGGACATAAGACAAGGACAGATACAGATCTGATCAGTCAATA 3' 3'| ТCGTACТСТС TTАТАТАССТGTAТТСТGTTCСTGТСТАТGTCТAGACTAGTCAGTTAT 5 " We will work with this gene for the next 5 questions
Transcribed Image Text:You are a scientist studying muscle cells. You are interested in making all of the muscle cells of a worm glow green. You have identified a muscle specific protein that is expressed in all muscle cells of the worm. You have also found a protein in jelly fish that glows green. You take all of the DNA from the glowing jelly fish gene between the +1 site and transcription termination, and par it with the promoter from the muscle gene from worms. You then take this new construct (shown below) and insert it into the genome of your worms using a virus. This virus inserts the DNA in a random place in the genome. MUSCLE PROMOTER GLOWING GENE FROM JELLY FISH 5 AGCATGAGAG ACATATATGGACATAAGACAAGGACAGATACAGATCTGATCAGTCAATA 3' 3'| ТCGTACТСТС TTАТАТАССТGTAТТСТGTTCСTGТСТАТGTCТAGACTAGTCAGTTAT 5 " We will work with this gene for the next 5 questions
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Environmental health & hazards
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS