6 4. You are investigating the DNA-binding interaction of the drug candidate below, which binds to DNA viaintercalation('(H3C)2NYou are lazy and don't want to do real computational simulations. You just estimate AHbinding based on thebinding motif, shown below (drug is flat molecule in middle sandwiched between adjacent DNA basepairs). What would you estimate? Explain how you arrived at this number. (an aromatic interaction -5kJ/mol)N(CH3)2а.b. OK, your boss convinces to do real energy calculations from computer simulations for a DNA segment.Values of energies and entropies (calc'd at 298 K) are given below. Calculate the drug-DNA bindingJconstant. R=8.314mol · KE (kJ/mol)-5984563MoleculeS (J/mol*K)DrugDNA segmentDrug-DNA complex-104752534255-98767883499677c. If you have a 10-base-pair segment of DNA, with 8 potential drug-binding sites, would you expect thedifferent binding sites to be cooperative, anti-cooperative, or non-cooperative? Explain.d. Is the DNA-drug binding enthalpically or entropically favored?

The study of interaction between drug and protein is very important to understand its mechanism of…

Answered: You are investigating the DNA-binding…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of a DNA polymerase and the reaction catalyzed by ligase.
The Qiagen DNeasy DNA extraction kit is used to extract DNA from a liver cell line for subsequent molecular experiments. (i) (ii) for checking DNA purity using a spectrophotometer. Explain the principle behind this kit in DNA extraction. After the DNA is obtained, the purity of DNA should be determined. Discuss the steps
The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBV
Compare the DNA binding modes of minor groove binding, intercalating, and crosslinking agents and explain how these interactions give rise to specific pharmaceutical applications. Use the molecular structures of at least one DNA PLEASE DISCUSS THIS IN DETAIL! and correct answers only ! will give good rating! thank you.
2) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.
COMPLEMENTARY BASE PAIRING 1. A B. C. D. E. F OMPTON 2. A. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus 77174: ATG TGTCA AAGACGGT CCTGTTTTGTA CCGTCAGGATTGA 6 GTTTTCATGCCTCCAAATCTT 10 The DNA of each species has a different base composition. Find the base composition of each species, using what you know about complement Human DNA is approximately 20%C
Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G]= [C], equalities now called Chargaff’s rule. Using this rule, determine the percentages of all the bases in DNA that is 20% thymine.
29.) equalities now called Chargaff's rule. Biochemist Erwin Chargaff was the first to note that, in DNA, [A]=[T] and [G]=[C], A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C] = [G] [T] = 20% %3D - B) If a single strand of RNA is 20% uracil, what can you predict about the percentages of the remaining bases and why?
1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.
31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a fluorescent label. *5'------3'-0H 3'------ATTACGCAAGGACATTAGAC---5' A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts. Lane 1: DATP, dTTP, dCTP, dGTP, ddTTP Lane 2: DATP, dTTP, dCTP, dGTP, ddCTP Lane 3: DATP, DTTP, dCTP, dGTP, ddATP Lane 4: DATP, dTTP, DCTP, dGTP, ddGTP The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes on the gel look like? ( Fill in the gel below.) 3 Electrophoresis Il||
In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.
(a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue while the protein residues are in black (M1 and M2 are metal ions, they are irrelevant to this question). 3' Base reaction. M² 5' 00 3' Glu 357 M¹ Draw the structure of the final DNA product for this reaction. Draw a square around the nucleophile and draw a circle around the leaving group in this Does this depict the reaction of an endonuclease or an exonuclease?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS