Thank u! You are a scientist studying muscle cells. You are interested in making allof the muscle cells of a worm glow green. You have identified a musclespecific protein that is expressed in all muscle cells of the worm. You havealso found a protein in jelly fish that glows green. You take all of the DNAfrom the glowing jelly fish gene between the +1 site and transcriptiontermination, and par it with the promoter from the muscle gene fromworms. You then take this new construct (shown below) and insert it intothe genome of your worms using a virus. This virus inserts the DNA in arandom place in the genome.MUSCLE PROMOTERGLOWING GENE FROM JELLY FISH5 AGCATGAGAG ACATATATGGACATAAGACAAGGACAGATACAGATCTGATCAGTCAATA 3'3'| ТCGTACТСТС TTАТАТАССТGTAТТСТGTTCСTGТСТАТGTCТAGACTAGTCAGTTAT 5 "We will work with this gene for the next 5 questions Using the DNA shown above (and copied here) translate the jelly fishprotein - NOTE the promoter is in RED5'AGCATGAGAGACATATATGGACATAAGACAAGGACAGATACAGATCTGATCAGTCAATA3'3'ТCGTACTСТСTGTАТАТАССTGTATТСТGTTCСТGTCТАТGTСТAGACTAGTCAGTTAT5'Second letterAUUUPheUUCUUUALeuUUGUCUUCCUCAUCGUAU TyrUAC SUAA Stop UGA Stop AUAG Stop UGG TrpUGUCysUGC.SerCUUCỤCCUACUGCCUCCCCACCGCGUCGCArgCAU)CAC HisCAAGlnCAGJLeuProCGACGGAAU AsnAAC.AAAAUUACUAGUAGCAGAAGGAUC leАCCSerAAUAThrACAAUG Met ACGAAG LysJArgGUUGUCValGAUGCUTGCCGCAGCGGACASPGGUGGCAlaGGA GlyGGGGUAGAAGAGJGUGGluFirst letterThird letterDUAGUUAGUCAGUCAG

You are a scientist studying muscle cells. You are interested in making all of the muscle cells of a worm glow green. You have identified a muscle specific protein that is expressed in all muscle cells of the worm. You have also found a protein in jelly fish that glows green. You take all of the DNA from the glowing jelly fish gene between the +1 site and transcription termination, and par it with the promoter from the muscle gene from worms. You then take this new construct (shown below) and insert it into

You are a scientist studying muscle cells. You are interested in making all of the muscle cells of a worm glow green. You have identified a muscle specific protein that is expressed in all muscle cells of the worm. You have also found a protein in jelly fish that glows green. You take all of the DNA from the glowing jelly fish gene between the +1 site and transcription termination, and par it with the promoter from the muscle gene from worms. You then take this new construct (shown below) and insert it into

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 8TYU: Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription...

See similar textbooks

Similar questions

") genes are atftected. PREDICT How might a mutation that affects a regulatory element, such as a promoter, transcription factor, or enhancer, affect the expression of a gene? Would the gene be expressed? If so, how might its expression change? Start Typing... DNA RNA polymerase gene enhancer TATA box promoter transcription factors
Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription of heterochromatin (c) produce related but different proteins in different tissues (d) amplify genes to meet the requirement of high levels of a gene product (e) bind transcription factors to enhancers to activate transcription
Cells go to great length to correctmistakes in the processes of DNAreplication, transcription, splicing,and translation. Are there analogousstrategies to correct mistakes in theselection of which genes are to beexpressed in a given cell type? Couldthe great complexity of transcriptioninitiation in animals and plants reflectsuch a strategy?
You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind etc…. I need the correct answer please From the list given - choose all components that you think are part of a typical eukaryotic gene
In eukaryotic cells, transcription cannot begin until(A) the two DNA strands have completely separated and exposed the promoter.(B) several transcription factors have bound to thepromoter
Below is a model of a signal transduction pathway that results in the transcribing of mRNA: Receptor protein Transcription factor Phosphorylation cascade DNA mRNA What is the best description of what would happen if the phosphorylation cascade resulted in a phosphate being attached to the transcription factor? O mRN would not stop being transcribed from the DNA. O The phosphorylation cascade would continue to release excess phosphates. O mRNA would stop being translated from the DNA. O Receptor proteins would not bind to the signaling hormone.
You are a research scientist working in genetic engineering. You create a piece of DNA that you want to express in E. coli, a prokaryote. This piece of DNA consists of a bacterial promoter, a ribosome binding sequence (RBS), a eukaryotic gene and a terminator sequence. Do you think that this piece of DNA would be expressed if placed into an E. coli cell that contains all the machinery needed for gene expression?
Which of the following is an example of post-transcriptionalcontrol of gene expression?(A) the addition of methyl groups to cytosine bases of DNA(B) the binding of transcription factors to a promoter(C) the removal of introns and alternative splicing of exons(D) gene amplification contributing to cancer
The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in YFG transcription. Diagram what this mutant interaction mightlook like
During the embryonic development of a fruit fly, bicoid protein regulates transcription in thenucleus. Transcription in fruit flies is similar to that in humans.The molecule that is most similar in function to the bicoid and the molecule that it binds to inorder to initiate transcription, respectively, are A. Molecule Most Similar to Bicoid Protein. Molecule that Bicoid Binds To RNA Polymerase DNA StrandB. Molecule Most Similar to Bicoid Protein Molecule that Bicoid Binds To DNA Polymerase DNA StrandC. Molecule Most Similar to Bicoid Protein Molecule that Bicoid Binds To RNA Polymerase mRNA StrandD. Molecule Most Similar to Bicoid Protein Molecule that Bicoid Binds To DNA polmerase…
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA