Write pseudo code to find fitness value function of 5-queens problem. (Add a text file, Use Indentation)
Q: Include arrays in this code.
A: An array is included in the code
Q: Take in a series of positive integers from the user, stopping when they enter a zero, and store them…
A: Perl Code using Map and Grep functions inside the array : Code : my @arr;my $count = 10; print…
Q: Q1:write program for reading matrix B(5,5), then interchange the element of (1st )column with the…
A: Here from question program declares or gives a two-dimensional array of size 5 rows and 5 columns.…
Q: Generate intermediate code for the code segment: (a>b) or (b
A: Intermediate code for the given code segment
Q: Sort an array RECURSIVELY using the insertion sort algorithm. (USE PYTHON and make sure your code…
A: import array# Recursive function to perform insertion sort on array `arr[i…n]`def insertion(arr, i,…
Q: Using the C programming language implement Heapsort in the manner described in class. Here is some…
A: Heap sort : Heap sort is a comparison-based sorting technique based on Binary Heap data structure.…
Q: Q1} write program to calculate the resistance, R, to fluid flow a long two pipe is connected where…
A: The answer is given below in MATLAB as no language is mentioned
Q: In PYTHON (Sum the major diagonal in a matrix) Write a function that sums all the numbers of the…
A: def sumMajorDiagonal(m):…
Q: Sum elements row by row) write a method that returns the sum of all the elements in a specified row…
A: Approach: here, we will use nested for loop to input 3 by 4 array elements. To calculate the sum of…
Q: Using “Def” keyword write a function that returns the Max element of the given array elements (The…
A: def MaxofArrayElements(arr): print("The maximum element of the array is:", max(arr))…
Q: Write a function that returns trueif the product of an array is divisible by the sum of that same…
A: Program def divisible(myList) : mul = 1 s=0 for x in myList: mul = mul * x for i…
Q: C++ Coding: Arrays Implement a 4x4 two-dimensional array of integers. Use a nested loop to…
A: The problem is based on the basics of 2D arrays and generation of random numbers and displaying…
Q: Q 1. How recursions are implemented in context to activation records? Give an example. (Example of…
A: 1) RECURSION: Recursion is a function that calls itself for several number of times.…
Q: 2. Modify the previous program such that function will print elements in reverse order. Enter Array…
A: //Code in JavaScript // let reverseorder = function(nums){ let temp; //temporary variable to…
Q: The Sum function is applied to values in a Pivot Table by default. How can I change this so that…
A: The above question that is The Sum function is applied to values in a Pivot Table by default. How…
Q: Write a test program that reads a 3-by-4 matrix and displays the sum of each row. Here is a sample…
A: import java.util.Scanner; public class Tester{ public static void main(String[] args) { Scanner…
Q: exam: Write program for read matrix x(4,4) then replace the first part of matrix with the fourth…
A: Since no programming language is mentioned, I am using c++. Since you didn't mention which part to…
Q: Give code to display array using loop in kotlin.
A: Que 1. Give code to display array using loop in Kotlin. Ans 1. Given, Programming language = Kotlin…
Q: Matrix Multiplication with OpenMP Write a program that calculates the product of two matrices, using…
A: Here is an sample code in C++ that uses OpenMP to parallelize matrix multiplication. The program…
Q: Exercise 5: For the given Boolean matrices, calculate A A B, A v B, A х В, and B хА 1 1 1 1 A = 1 1…
A: This question comes from Discrete Mathematics which is a paper of Computer Science. Let's discuss it…
Q: Fill in the correct blanks. Matrices can be created by row-binding using ____ function of R.
A: Answer: The correct answer is rbind() function which is created for row-binding in the R programming
Q: Using “Def” keyword write a function that returns the Max element of the given array elements (The…
A: Python is an interpreted, object-oriented, high-level programming language with dynamic semantics.…
Q: onvert it in row.
A: Naive Bayes: It is the probabilistic machine learning algorithm. As we know Naive Bayes is a simple…
Q: Write a for loop to print all elements in courseGrades, following each element with a space…
A: Here is the c++ code. see below step for code.
Q: public class Timel extends Object { private int hour; private int minute; private int second; public…
A: -> It is a library for formating into DecimalFormat. -> It is a constructor of class Time1…
Q: Application: Big-O Notation (Q8-11) For each of the time complexities in this segment give the…
A: In the context of algorithm analysis, the tightest bound refers to the most accurate and precise…
Q: Write JAVA code that prints table of 5 using for loop
A: Given: Write JAVA code that prints table of 5 using for loop
Q: Write a program that prompts the user to input an integer and then outputs both the individual…
A: DESKTOP-AEK0RBP Here's your serial number: 46GCDFU6Y6NH263 MS Office: XQNVK-8JYDB-WJ9W3-YJ8YR-WFG99…
Q: Using “Def” keyword write a function that returns the mean element of the given array elements (The…
A: NOTE: - Here I also write the instructions to follow for your better understanding. CODE :- #…
Q: Do this using C++. Initialize an integer array with random number between 0 to 51 using rand()…
A: Sample Response: //C++ program to initialize an integer array with random number between 0 to 51…
Q: 1- Write a for loop that will print the column of real numbers from 1.5 to 3.1 in steps of 0.2.
A: According to the Bartleby guideline, we are supposed to answer only one question at a time. Kindly…
Q: C++ Coding: Arrays Implement a 4x4 two-dimensional array of integers. Use a nested loop to…
A: Answer: #include<iostream>using namespace std; int main() //main function{int…
Write pseudo code to find fitness value function of 5-queens problem. (Add a text file, Use Indentation)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What does this code print? [x for x in range (5)] [x for x in range(7) if x in data and x%2==0] data print(temp)[Python (py3)] The code below can already solve for matrix addition. Please add the code for matrix scalar multiplication. The input will come from file1.txt, and the output should be printed to output.txt Format of the input from file1.txt:First Line: type of operation (add or scalmultiply)Second Line: matrix A dimension (example: if 3 rows and 2 columns, type 3 2)Third Line: matrix A elementsFourth Line: matrix B dimension (or the scalar number for the operation of scalar multiplication)Fifth Line: matrix B elements (not needed for scalar multiplication)Sample input 1:scalMultiply2 253 -47 312Sample output 1:106 -814 62 ---------------------------------------------------------------------------------- import numpy as npimport sys f1 = open("file1.txt","r")lines = f1.readlines()dim = lines[1].split()k=2mat1 = np.empty((0,int(dim[0])), int)for i in range(0,int(dim[0])): l = lines[k].split() l = list(map(int, l)) ls = np.array([l]) k += 1 mat1 = np.append(mat1, ls,…Note: solution use MATLAB 1- Write a for loop that will print the column of real numbers from 1.5 to 3.1 in steps of 0.2. 2- Create a for loop that allows the user to input a number and it gives back the numbers factorial. 3- Create the following vector using for loop x= [2 2³ 25 27 2⁹] 4- Create the following matrix using for nested loops 12 3 x = 1 2 3 1 2 3 5- Create 10 random numbers between -10 and 10. And then use for loop and if condition to count the positive numbers. 6- If the inverse of exponential is given as: 1/e= (1-1)" Write a script that will loop through values of n from 1 to 1000, and will stop if - (₁-1) | < < 0.001
- (Python matplotlib or seaborn) CPU Usage We have the hourly average CPU usage for a worker's computer over the course of a week. Each row of data represents a day of the week starting with Monday. Each column of data is an hour in the day starting with 0 being midnight. Create a chart that shows the CPU usage over the week. You should be able to answer the following questions using the chart: When does the worker typically take lunch? Did the worker do work on the weekend? On which weekday did the worker start working on their computer at the latest hour? cpu_usage = [ [2, 2, 4, 2, 4, 1, 1, 4, 4, 12, 22, 23, 45, 9, 33, 56, 23, 40, 21, 6, 6, 2, 2, 3], # Monday [1, 2, 3, 2, 3, 2, 3, 2, 7, 22, 45, 44, 33, 9, 23, 19, 33, 56, 12, 2, 3, 1, 2, 2], # Tuesday [2, 3, 1, 2, 4, 4, 2, 2, 1, 2, 5, 31, 54, 7, 6, 34, 68, 34, 49, 6, 6, 2, 2, 3], # Wednesday [1, 2, 3, 2, 4, 1, 2, 4, 1, 17, 24, 18, 41, 3, 44, 42, 12, 36, 41, 2, 2, 4, 2, 4], # Thursday [4, 1, 2, 2, 3, 2, 5, 1, 2, 12, 33, 27, 43, 8,…Q 1. How recursions are implemented in context to activation records? Give an example. (Example of factorial is not allowed)Write answer in your own words. Q2. Write a program that will sort an element of a linear array using Selection Sort method. After sorting the array, the program will search the element from the sorted array usingBinary Search method. (Use C++ language)Please do not give solution in image format thanku Create a test program that creates 4 array lists. Make use of the random function and place 8 (matching/pairs of) different int values in the four lists. Remember the objective of the game is to find matching pairs so you must make sure that each value you enter has got another matching value. But it will also create problems if a value is entered more than 2 times in the 4 lists. Hint make use of getCount. (10) Test the methods created and the working of the placement of the default values.
- Please write your own code and put some commentary. Thank youPlease write your own code, put some commentary for my own understanding. Thank youplease code in python """ TODOReturn whether the pattern was found or not (found), the number of times the pattern was found (n), all starting positions at which the pattern was found (positions) and the number of comparisons.""" Given text: CAGTCAGTCATCATGCGTATCAGCTGATC TATCGGGCGCGCGCGTATCATC Combinations to look for: TGCGTATCAGCTCGCGCG TATGTCA
- This is done in Perl. Take in a series of positive integers from the user, stopping when they enter a zero, and store them into an array. a) Use a for each loop to print the square of each number if the square is between 100 and 200. b) Use the map and grep functions to do the same as in (a).Problem Definition Task. Your task is to develop a python program that reads input from text file and finds if the alphanumeric sequence in each line of the provided input file is valid for Omani car license plate. The rules for valid sequences for car plates in Oman are as follows: Each sequence is composed of 1 to 5 digits followed by one or two letters. Digits cannot start with 0, for instance, 00, 011, or 09 are not valid digit sequences. The following list are the only valid letter combinations: ['A','AA','AB','AD','AR','AM','AW",'AY"', 'B', BA','BB','BD',"BR','BM',"BW',"BY', 'D','DA','DD','DR','DW','DY', 'R','RA','RR','RM','RW','RY', 'S','SS', 'M','MA','MB','MM','MW','MY", "W',"WA',WB',"wW', Y,YA','YB','YD','YR','YW',YY] Program Input/Output. Your program should read input from a file named plates.txt and write lines with valid sequences to a file named valid.txt. Any line from the input file containing invalid sequence should be written to a file named invalid.txt. Each line…Code with comments and output screenshot is must. No copy paste answer please !!
