Write an algorithm that computes the Body Mass Index (BMI) given the heights and weights of students. The algorithm should first read the total number of students and then read the height and weight of each student to calculate and print the BMI category. A student is considered Underweight if the BMI is less than or equal to 18.5; Normal Weight if between 18.5 and 24.9; Overweight if between 25 and 29.9; and Obese if greater than or equal to 30.

Write an algorithm that computes the Body Mass Index (BMI) given the heights and weights of students. The algorithm should first read the total number of students and then read the height and weight of each student to calculate and print the BMI category. A student is considered Underweight if the BMI is less than or equal to 18.5; Normal Weight if between 18.5 and 24.9; Overweight if between 25 and 29.9; and Obese if greater than or equal to 30.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT
Design an algorithm or function to find the longest substring which contains 2 unique characters in a given string. You may list steps or psuedo code. Example: In the string "abaacacaacda" return "aacacaac"
Leap years have 366 days (29 Any year that is divisible by 4 but not by 100 is a leap year. If a year is divisible by 400 then it is also a leap year. So in short any year that is divisible by 4 is a leap year, unless it is divisible by 100, in which case it must also be divisible by 400 for it to be a leap year. Example: 1996 and 2000 were leap years, but 1900 was not. days in February).
In programming language C.Write an algorithm to input a number. Find its square if the entered number is multiple of 10. If entered number if not a multiple of 10, then find its cube.
JAVA algorithm ur pseudo-code ,, top-down, stepwise refinement. Write a Java program.. Baker Co pays commision. Salesppl get $200 a wk nd 9% of their gross sales per wk. You’ve been supplied with a list of the items sold by each salesperson. The values of these items are in pic, app inputs one 1 sale ladys items sold for last wk and calculates and shows her earnings. She can sell any amnt
c) Write pseudo-code for the algorithm that will ask the user to enter height (Feet) and weight (Kg) of the person. Algorithm will first categorize the person (1, 2, 3) according to height as shown in table. For given category, if weight of the person is in the given range, display message 'You are Fit', If weight is greater than the given range, display You are over weight', If weight is less than the given weight, 'Display You are under weight'. Category Height Weight 1 4.5 to 4.9 Feet 40 – 50 Kg 2 5.0 to 5.5 Feet 45 - 55 Kg 5.6 to 6.4 Feet 60 – 80 Kg 3
¬∀x∀y∃z P(x, y, z) has the same truth value as ___. Group of answer choices ¬∃x∃y∀z P(x, y, z) ∀x∀y∃z ¬P(x, y, z) ∃x∃y∀z P(x, y, z) ∃x¬∀y∃z P(x, y, z) ¬∀x∀y A(x, y) has the same truth value as ___. ∀x¬∃y A(x, y) ∃x¬∀y A(x, y) ∀x∀y ¬A(x, y) ∀x∃y ¬A(x, y) ¬∃x∀y∃z (x – y < z) has the same truth value as ___. ∀x∃y∀z (x – y ≥ z) ∀x∃y∃z (x – y ≥ z) ∃x∀y∃z (x – y < z) ∀x∃y∀z (x – y > z)
Transient PopulationPopulations are affected by the birth and death rate, as well as the number of people who move in and out each year. The birth rate is the percentage increase of the population due to births and the death rate is the percentage decrease of the population due to deaths. Write a program that displays the size of a population for any number of years. The program should ask for the following data: The starting size of a population P The annual birth rate (as a percentage of the population expressed as a fraction in decimal form)B The annual death rate (as a percentage of the population expressed as a fraction in decimal form)D The average annual number of people who have arrived A The average annual number of people who have moved away M The number of years to display nYears Write a function that calculates the size of the population after a year. To calculate the new population after one year, this function should use the formulaN = P + BP - DP + A - Mwhere N is the…
Example-6 A number of rivers (N), each river has three (pH) values. Write a program to read the (pH) values and find the average for each river, then print the state of water (neutral, acidic, alkaline). if pH =7 neutral pH > 7 alkaline pH
The computed approximation should be accurate to less equal to 10 decimal places (i.e., the absolute value of nin+1) the sum result of current kth iteration subtract from the sum result of the previous (k-1)th iteration is less equal to 0.01). The program should display the approximation of the series and the error bound. An alternating series that converges has an error bound equal to the magnitude of the next term in the series, for example if was approximated (-1)-1 nin+1) using N = 3, (-1)-*, the error bound is (-1)" with n = 4, nin+1) .
Design an algorithm for a problem that processes results of a swimming competition. The program will set a number of competitors, obtain their names from the user, and uses random number generator to get the results (in seconds, as real numbers with three digits after the decimal point). Then it will find and display the average timefor all competitors, andthe names and best three results (first, second, and third places). 1. Set a number of competitors as a constant TOTAL (no more than 10) 2. Declare two arrays to hold names and results (an actual array should have different name than the formal array in the function definitions) 3. Call functions to fill the arrays with names (user entries) and results (random decimal numbers) 4. Print all names and results as a table with appropriate titles 5. Display the average time (by calling function getAverage()) 6. Sort the array of results and corresponding names 7. Print names and results for the first three places (first…
The square root value of a number x can be estimated using the following mathematical equation: - In(x) Vx = e2 %3D where e=2.718282, and In is the natural logarithm Write an algorithm (Step 4 of problem solving methodology) that reads a positive integer from a user then computes the square root of that integer using the above-mentioned formula. The algorithm repeats the same process for five positive integers. [Hint: use any repetition structure]