Write a python program to get the document file content of some inbuilt modules. You can assume two modules are calendar and Mimetypes
Q: Write a Python program the gets two numbers from the user and prints out the largest of the two.…
A: Here is the python code. See below step for code.
Q: Write a Python program that reads from a text file the last names of five candidates in a local…
A: 1. Start.2. Input: - Prompt the user to enter the filename where the candidates' last names and…
Q: Write a python script that reads the file studentNames.txt which contains the names of students.…
A: CODE in Python: # Open the file in read modewith open("studentNames.txt", "r") as file: # Print…
Q: Write a python program that can identify all days when only one movie was added to Netflix catalog.…
A: Please find the answer below :
Q: Python Module that has a function to go on this website
A: webbrowser module: It is a user friendly module to display web-based documents and control the web…
Q: Present the user with a list of top Sega games, then prompt the user for which one they would like…
A: Code in step 2
Q: For Python, using IDLE Write a program to pull text information from a PDF document including 2…
A: Below is the complete solution with explanation in detail for the given question in Python…
Q: Create a python program using the following built-in module date/time. You can also use the example…
A: Algorithm :- 1. Start 2. Import the datetime module 3. Create the timedelta object by passing…
Q: ake a python program that does the following. Make sure that it works and interfaces with the user…
A: Dear Student, The required code along with implementation and expected output is given below -
Q: Write a C program to manage 50 bank accounts. The accounts are identified by numbers ranging from…
A: The program's algorithm:1. Initialize bank account struct arrays. Each struct needs a bankaccount…
Q: Your program must conform to the following specifications! 1) Represent the three pegs and disks as…
A:
Q: Create a Python script that generates information about an available accommodation. The described…
A: Define a class Accommodation to encapsulate information about the accommodation.Initialize the class…
Q: Create a program that try to print a non existing variable and print a message telling the user that…
A: Solution :
Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…
A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…
Q: Given the temperature t (in Fahrenheit) and the wind speed v (in miles per hour), the National…
A: Steps to write the code is : 1. checking number of the command line arguments is 3 2. converting the…
Q: The initial temperature at the outlet of the exchanger is 100°C, and the percentage of opening…
A: ALGORITHM:- 1. Considering the temperature will rise as the pressure increases by the equation:-…
Q: p a crawler that collects the email addresses in the visited web pages. You can write a function…
A: Step 1: Below the function emails() that takes a document (as a string) as input and returns the…
Q: Python program in a .py file that includes the following: Define and test a function…
A: Write a Python program in a .py file that includes the following: Define and test a function…
Q: Design a PYTHON program to process the exam scores of a list of students whose name-surname, student…
A: The required Python code is: def calcGrade(num): if num >= 85: return 'A' elif num…
Q: Write a Python program the gets two numbers from the user and prints out the largest of the two.…
A: Program: print("Please enter two numbers:")#reading 2 numbersa,b=[int(i) for i in…
Q: Write a python program that asks the user's name and the user's age. The program computes the year…
A: The program is written in Python. Check the program screenshot for the correct indentation. Please…
Q: Python
A: Answer:- Python Code:- def addAttendee(): obj = {} # dictionary for storing details obj["name"] =…
Q: Develop a Python program to process an unknown number of exam scores, using a loop. The exam…
A: Algorithm steps to solve the given problem: Start Initialize variables A_count, B_count, C_count,…
Q: This is for Python Write a program that takes a first name as the input, and outputs a welcome…
A: Algorithm: 1. Start 2. Prompt the user for their first name. 3. Store the name in a variable. 4.…
Q: Write a python script that reads the file student.txt which contains the names of students(first…
A: - We need to print out the student names from student files.
Q: So for my project program in Python I'm suppose to code a BankApp in which the user is suppose to…
A: It appears make sure the deposit and withdrawal functionalities handle negative numbers…
Q: write a program to enter a user name and display the message (hello) three times. The first one for…
A: Python used to answer this question
Q: Write a program in Python that should output like using range: .... ........> I.......... 1…
A: ALGORITHM:- 1. Use range() to traverse through the rows. 2. Use conditional statement to get the row…
Q: Write a program in python that can fetch the top 1000 news articles from Google news everyday and…
A: See the code below:-
Q: Write a Python function to run a Parking Lot (PL) simulation, called PLSimulation, which takes four…
A: Define a function called PLSimulation with 4 parameters: minArriving, maxArriving, maxLeaving, and…
Q: need a python code which expands a web slide(full screen mode) and take screenshot of it(until last…
A: Solution: #python code: #import necessary files from libraries import sys#imoprt files from system…
Q: Write a Python program that will ask a user for a number, then determine whether it is odd or even.…
A: I give the code in Python along with output and code screenshot
Q: Create and deploy a programme that can read up to 25 pairs of names and postal (ZIP) codes for each…
A: The code reads each line of input, splits it into the first name, last name, and postal code using…
Q: 1. One Python function per room. 2. It should include the all the print out of the room description…
A: Define functions for each room. In the main function, Set the starting room. Start a loop till game…
Q: I want to write a python project asking the user to do house chores.
A: Solution #House Chore App #Welcome to your House Chore App! print("Welcome to your House Chore…
Q: Develop a python program that will determine the required mass of one compound based on three…
A: Read the input from the "input.txt" file.Remove the header line from the input data.Initialize an…
Q: Write a python login program that has input validation that accepts an only string as user name.
A: Python programming: Python is a high-level programming language with dynamic semantics. It is an…
Q: Create a python program (Paper-Rock-Scissor Game) There are two user ( player 1, player 2) who will…
A: Program code: # Python Version 3from random import randint # main functiondef main(): # Define a…
Q: Write a Python function that creates a csv file that includes a price list of user-entered items.…
A: In this programming question we have to execute a program in python This program we have to write to…
Q: Develop a python program that will determine the required mass of one compound based on three…
A: Overview of the approach used in the code:The program consists of two main files: compound.py and…
Q: Please write a python program that can send ICS Calendar invites in python 3.7. Share screenshots of…
A:
Q: Write a program in python that can fetch the top 1000 news articles from Google news and then search…
A: The program is implemented below in python code:
Step by step
Solved in 4 steps with 3 images
- Make a programme in Python that does a Google search and calls it google search. If you type anything into Google, it will return the best results in the form of links.Create a program in Python that will ask the user for two inputs: a code and a message. Make a function that will check for the following constraints: For the code, it must only have the letters 'a' or 'b' (can be both). The length must be at least 3 and at most, 10. For the message, it must only contain characters from the ASCII table with values between 32 and 126. The length must be at least 5 and at most, 50 characters. If the constaints are met, print "Input are valid and accepted." If not, print "Inputs invalid! Please enter code and message again." Keep asking for the code and message until both inputs are valid.Write a main function in python that calls your functions to create the CSV file containing all of the anagrams using "words.txt" as the original input file. After you have written the file, print all of the anagrams that only match a single word to standard output.
- So for my project program in Python I'm suppose to code a BankApp in which the user is suppose to input their username and password to access their balance details and withdraw or deposit money. The program works though there is a small issue. See when testing I notice a problem with the withdraw and deposit function, see if I put a negative value rather than saying "invalid" and looping back to the menu it will do the opposite which I'll provide a screenshot to explain it better. Can you fix and explain how you did it(also show a sceenshot on where you fix/added code)&(UserInfo will also be provided for code to work)-Thank you. Code def read_user_information(filename): usernames = [] passwords = [] balances = [] try: with open(filename, "r") as file: lines = file.readlines() for line in lines[2:]: data = line.strip().split() if len(data) == 3: usernames.append(data[0])…Applying object oriented programming, do a python program that will determine the required mass of one compound based on three parameters: (1) compound name, (2) liters of solution, and (3) molarity. The input should be in a single text file (input.txt). The required mass should be in a single text file (output.txt). Only two decimal places should be included in the output.txt. Example: *input.txt* compound,liter,molarity NH4Cl, 0.1, 2.5 NaCl, 0.5, 0.25 Na2CO3, 0.75, 1.25 *output.txt* 13.37 7.31 99.36Make a programme in Python that does a Google search and calls it google search. If you type anything into Google, it will return the best results in the form of links.
- Generate a python program that will give an output of an image of a flowerDesign a modular program in Python to process payroll for all hourly paid employees, save all the data into a text file and make a backup file as well. The program should allow user enter each employee's ID, name, hours worked, and hourly pay rate. And then calculate gross pay with overtime hours(hours beyond 40) paid 50% more. And then the program should display pay statement for each employee and store them into a same text file. The program should display total number of employees, total number of hours worked by all employees, and total gross pay and save them at the end of the same text file as well. The program should contain the following functions: main(), get_employee_info(), calc_gross_pay(hours, rate), display_pay_statement(emp_id, emp_name, hours_horked, hourly_pay_rate, gross_pay), save_pay_statement_to_file(file_object, emp_id, emp_name, hours_worked, hourly_pay_rate, gross_pay), save_summary_to_file(file_object, number_of_employees, total_hours_worked, total_gross_pay).…Create a Python software that requests the user for the surface tension of the water, the area, and the thickness of the film sandwiched between two plates, and then shows the force necessary to separate the two plates.
- Python Create a program that reads the file (create a paragraph in a file). It should analyze each character of the file. For output, it should produce a well-formatted table indicating: The total number of printable characters The total number of capital letters The total number of lowercase letters The total number of numbers The total number of sentences (which end in a period) The total number of paragraphs (which end in a newline) Since the lab is an exercise in strings, you must use at least TWO different string methods to required information.Write a python program based on the images. The program should have at least five products.Create a Python programme that inputs a list of strings into a dynamic array. Allow the user to input as many pieces as they like, and then to remove them as necessary? Explain each line, please?