Please provide workable code in python that solves question 4. Please note that I am not looking for an explanation, but code. CpG island HMMOur next goal is to find CpG islands in a sequence. To do this we will need to generate an A, E and I matrix for the HMM. The A and E matrix can be obtainedempirically given sequences with known CpG islands within them. However, in this case lets start by assuming this has already been done to produce thefollowing:AGAIOIO0.8 0.20.2 0.8For I let's assume equal chances at the start [0.5, 0.5].E|CT0.1 0.4 0.4 0.1O 0.25 0.25 0.25 0.25Question 4Write a new viterbi function to calculate the most likely path of a sequence given A, E, and I matrices.What is the most likely path of the following sequence:GTTACTTATATAGCTTACTTCAAGGCGAGTCTCGGAGCCGCGCCCAACCGATGCTAATAAAATTTCTGTTTTGYour function should output the sequence with the hidden states (1,O) above it. To check, your code should generate:00000000000000000000000IIIIIIIIIIIIIIIIIIIIII0000000000000000000000000000GTTACTTATATAGCTTACTTCAAGGCGAGTCTCGGAGCCGCGCCCAACCGATGCTAATAAAATTTCTGTTTTG

Here is a Python implementation of the Viterbi algorithm to calculate the most likely path of a…

Write a new viterbi function to calculate the most likely path of a sequence given A, E, and I matri What is the most likely path of the following sequence: GTTACTTATATAGCTTACTTCAAGGCGAGTCTCGGAGCCGCGCCCAACCGATGCTAATAAAATTTCT Your function should output the sequence with the hidden states (1,O) above it. To check, your cod 00000000000000000000000IIIIIIIIIIIIIIIIIIIIII000000000000000000000000000 GTTACTTATATAGCTTACTTCAAGGCGAGTCTCGGAGCCGCGCCCAACCGATGCTAATAAAATTTCTGTTTTO

Write a new viterbi function to calculate the most likely path of a sequence given A, E, and I matri What is the most likely path of the following sequence: GTTACTTATATAGCTTACTTCAAGGCGAGTCTCGGAGCCGCGCCCAACCGATGCTAATAAAATTTCT Your function should output the sequence with the hidden states (1,O) above it. To check, your cod 00000000000000000000000IIIIIIIIIIIIIIIIIIIIII000000000000000000000000000 GTTACTTATATAGCTTACTTCAAGGCGAGTCTCGGAGCCGCGCCCAACCGATGCTAATAAAATTTCTGTTTTO

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Question: Application of templates in terms of object oriented programming. Provide STEP BY STEP DETAILS CORRECT SOLUTION. Don’t copy others work.
Explore the concept of dictionary comprehension in Python. Provide examples and discuss its benefits.
Describe inheritance and provide an example of how it is used Language Python.
Question 2 This question provides an opportunity for you to demonstrate your understanding of the problem-solving approach taught in TM112 and the patterns introduced in Block 1 Part 4 and Block 2 Part 2. You can find an overview of the problem-solving approach and a list of all the patterns TM112 teaches in the Problem solving and Python quick reference and you will need to refer to this document as you work on the question. Important note: you do not need to get a working program in part a. in order to attempt part b. A student wants to design and implement a Python program to convert any 6-bit unsigned binary number to its decimal equivalent. There are many ways of doing this, but here is their initial top-level decomposition: • > Convert binary to decimal o >> Input a list of six 1s and 0s corresponding to the binary number to be converted o >> Input a list of six column weightings consisting of powers of two o >> Create a new list that contains the…
Please answer the below images with a detailed solution and a full explanation. Answer the question like you are answering an engineer's question. For the coding questions, please use both Java and C++.
Discuss the mutability of dictionaries in Python and how it affects their usage in various scenarios.
Python. Which one of the statement about inheritance is correct ?
What are the different ways of representing comments or remarks in Python? Give suitable examples.
I want in Python code not in java code. I need explanation step by step
Can you please give me an approach or two as to how to tackle this problem using the programming language C? I get that it is complex, but please, I really need your help with this one.
How languages pass parameters varies greatly. ALGOL, Pascal, Ada, C, C++, Java, and C# pass arguments differently. Choose the language with the best parameter-passing technique. Explain why you choose your language's approach and why others' are inferior.
Need to be in Python Given some components that have dependencies, find the order in which compilation should take place. A -> B B - C, D D -> E, F E -> F -> C CFEDBA