Write a C++ program to implement the LCS algorithm covered in class for finding the Longest Common Subsequence (LCS) of two sequences. Provide comprehensive comments and explanations within your code to elucidate the logic and implementation of the dynamic programming approach. Note that LCS is different from a common substring. Test your program with the following two cases to verify the correctness of your implementation: Test Case 1: Given two sequences X and Y: X= (A, B, C, B, D, A, B) and Y = (B, D, C, A, B, A) Test Case 2: Given two gene sequences S1 and S2: S₁ = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S₂ = GTCGTTCGGAATGCCGTTGCTCTGTAAA

Write a C++ program to implement the LCS algorithm covered in class for finding the Longest Common Subsequence (LCS) of two sequences. Provide comprehensive comments and explanations within your code to elucidate the logic and implementation of the dynamic programming approach. Note that LCS is different from a common substring. Test your program with the following two cases to verify the correctness of your implementation: Test Case 1: Given two sequences X and Y: X= (A, B, C, B, D, A, B) and Y = (B, D, C, A, B, A) Test Case 2: Given two gene sequences S1 and S2: S₁ = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S₂ = GTCGTTCGGAATGCCGTTGCTCTGTAAA

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

code a python function (sat) that solves the satisfiability of the clause set by running through all truth assignments. In case the clause set is satisfiable it should output a satisfying assignment. A full (truth) assignment should be represented by a list of literals.
Solved in python
In C++, please and thank you.
Write a function in MATLAB that has two inputs: - A shear load (as the first input) - A tensile load (as the second input) Have your function return one output, a string with the name of the lowest grade material from Table 1 that can handle those loads.
The two most recent operands are popped in the postfix expression evaluation example whenever an operator is met so that the subexpression may be evaluated. In the subexpression, the first operand popped is regarded as the second operand, and the second operand popped as the first. Give a case study that exemplifies the significance of this component of the solution.
In Kotlin, Write a recursive function called myZip, with an expression body. MyZip takes two Lists and returns a List of Pairs in which each value may be any type (I suggest your start by thinking out how to represent this data type). The pairs consist of corresponding elements in the two lists (the first element of the first list and the first element of the second list, etc). The base case should be that either (or both) of the original lists has length 1, so that, if the lists have different length, the zipping stops when the first list runs out of values.
Write the code in python to define the function has_adjacent_repeats(mystr), which takes a string parameter and returns a boolean result. - If mystr has at least one instance of adjacent characters being equal, return True - Otherwise, return False Hint: You can iterate over the positive indices i for characters in mystr: 1, 2, 3, ...., len(mystr)-1 with a for loop. For each i, if the character at index i matches the character at index i - 1, return True. Otherwise, if no doubled character is found in the entire string, return False. For example: Test Result if not (has_adjacent_repeats("NOODLES") is True): print("error") if not (has_adjacent_repeats("Bananas") is False): print("shwoopsie") if not (has_adjacent_repeats("Hanoverr") is True): print("error")
python help... Write a function justVowels() that takes a string as a parameter and returns a new string that contains all the vowels found in the parameter string. The vowels in the returned string should appear in the same order as they did in the parameter string. A vowel is one of a, e, i, o, or u. both the upper- and lower-case vowels should be included. The characters in the returned string should have the same capitalization as they did in the parameter string. If the function is given a string without any vowels or an empty string, it should return the empty string. Use the if-else condition with iterate loop pattern. Don’t forget to include the docstring and comments. How it should run... >>> justVowels('Did you include your collaboration statement') 'iouiueouoaoaioaee' >>> justVowels('If you did not include your collaboration statement no points') 'Iouioiueouoaoaioaeeooi' >>> justVowels('1,2,3,4,...') '' >>> justVowels('') ''
The same professor writes a program to analyze the chat logs from the various lectures as a partial measure of class participation. Each chat log consists of multiple lines, each of form TIME, NAME, COMMENT, in the order in which they were posted to the chat . The algorithm then sorts all that data - across all the chat logs - in order of student names, and scores each set using a metric based on the number of contributions and their length. [a] What are the various input sizes to consider when analyzing the algorithmic approaches? (One is the number of students in the class, but that is not the only factor.) [b] Which sorting algorithm do you think is best suited for the sorting portion of this algorithm and why? [c] What is the time complexity of the sorting algorithm chosen in step [b] as a function of the various input sizes identified in step [a]? [d] What is the overall time complexity of the chat analysis program as described above?
write using python
Write a one sentence description of this function and suggest a more descriptive name. int func1(double x) {return (int)(x + 0.5); }
Write a python function format prop that allows to print a proposition in Propositional Logic using theindicated list representation. Consider the connectives: ∨, ∧, =⇒, ⇐⇒, ¬. and ⊕ (XOR). In the code,they will be written, respectively, as: or, and, if, iff, not, xor.