Write a C++ program to implement the LCS algorithm covered in class for finding the Longest Common Subsequence (LCS) of two sequences. Provide comprehensive comments and explanations within your code to elucidate the logic and implementation of the dynamic programming approach. Note that LCS is different from a common substring. Test your program with the following two cases to verify the correctness of your implementation: Test Case 1: Given two sequences X and Y: X= (A, B, C, B, D, A, B) and Y = (B, D, C, A, B, A) Test Case 2: Given two gene sequences S1 and S2: S₁ = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S₂ = GTCGTTCGGAATGCCGTTGCTCTGTAAA

Write a C++ program to implement the LCS algorithm covered in class for finding the Longest Common Subsequence (LCS) of two sequences. Provide comprehensive comments and explanations within your code to elucidate the logic and implementation of the dynamic programming approach. Note that LCS is different from a common substring. Test your program with the following two cases to verify the correctness of your implementation: Test Case 1: Given two sequences X and Y: X= (A, B, C, B, D, A, B) and Y = (B, D, C, A, B, A) Test Case 2: Given two gene sequences S1 and S2: S₁ = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S₂ = GTCGTTCGGAATGCCGTTGCTCTGTAAA

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Must be new solution and run on GNU Common Lisp! Using Lisp, write a program that solves the Missionaries and Cannibals problem that uses a DFS( depth first search). It should use (mac start end). Start is the current state (which can be (3 3 l) and End is the goal state (which can be (0 0 r). This should output the sequences of moves needed to reach the end state from the start state. This should print nil if there is no solution. For example, the call should be something like this! Call: (mac '(3 3 l) '(0 0 r)) Output: ((3 3 l) (2 2 r) (3 2 l) (3 0 r) (3 1 l) (1 1 r) (2 2 l) (0 2 r) (0 3 l) (0 1 r) (1 1 l) (0 0 r))
A recursive function is a function defined in terms of itself via self-referential expressions. This means that the function will continue to call itself and repeat its behavior until some condition is met to return a result. a- Write a python recursive function prod that takes x as an argument, and returns the result where, result=1*1/2*1/3*….*1/n b- Include a screenshot that shows a python program that uses the above function and prints the rounded result to three decimal places after prompting the user to enter a number, x. Use x=3. N.B: The code should be included in your answer.
Write a program in C that, given two points on a two-dimensional graph, outputs a message (string) if the line that connects them is horizontal or vertical, or if the slope is positive or negative.What would you modify or adjust in your code if we move from a 2D cartesian system to a 3D dimensional cartesian system?You need to take into consideration if the system is 3D and therefore you need to ask the user to insert X, Y , and Z.
In Kotlin, Write a recursive function called myZip, with an expression body. MyZip takes two Lists and returns a List of Pairs in which each value may be any type (I suggest your start by thinking out how to represent this data type). The pairs consist of corresponding elements in the two lists (the first element of the first list and the first element of the second list, etc). The base case should be that either (or both) of the original lists has length 1, so that, if the lists have different length, the zipping stops when the first list runs out of values.
Write an iterative function that determines the number of even elements in an array a of integers of size n. The function should return the number of elements that are even in array a of size n. Propose an appropriate prototype for your function and then write its code. Write a recursive function to solve the above problem. Propose an appropriate prototype for your function and then write its code.
Finding the longest common substring in two strings is a problem that lends itself to a dynamic programming solution. For example, the longest common substring in the terms "raven" and "havoc" is "av". Create a whole programme in C# for it.
Give an example of a while loop, then provide the equivalent do-while loop and for loop. Then give a different example of a do-while loop, along with the equivalent while loop and for loop. Finally, give an example of a for loop, along with the equivalent while loop and do-while loop. Use your examples to illustrate the advantages and disadvantages of each looping structure, and describe those advantages and disadvantages.
Write a recursive Racket function "update-if" that takes two functions, f and g, and a list xs as parameters and evaluates to a list. f will be a function that takes one parameter and evaluates true or false. g will be a function that takes one parameter and evaluates to some output. The result of update-if should be a list of items such that if x is in xs and (f x) is true, then (g x) is in the list. The output list's elements should keep the input list's items in the same relative order. For example (update-if even? add1 '(1 2 3 4)) should evaluate to '(3 5) because 2 and 4 make even? true and add1 turns 2 and 4 into 3 and 5.
Write a tail-call recursive function in the Racket language called circles. This function should take two numbers, x and size, and a Scene scn. If size is less-than or equal to 2, then your function returns the scn unchanged (base case). Otherwise, your function should place a circle in the Scene that results from a recursive call to circles with x shifted by (+size (next-size size)), a new size of (next-size size), and using the original Scene. After evaluating such as (circles 100 48 ES), your function should output an image of five blue circles, with the first circle at (x,y) coordinate position (100, 80):
c++ Implement a recursive function that determines whether a string is a palindrome or not. A word is a palindrome if the word looks the same when written backwards. For example. kayak → kayak, but not ball → llob. The function only needs to handle whole words. No special characters or spaces appear in the strings. You do not have to deal with case sensitivity. You get a parameter from stdin: str the text string Input Expected outputkayak 1boll 0naturrutan 1
Write a recursive function, numMoves(), that takes a number representing the number of disks in the Hanoi problem, and returns the number of moves involved. I recommend you start writing this function by modifying the hanoi.py program given. Test cases: numMoves(3) should return 7 and numMoves(4) should return 15. Do not use any global variables. hanoi.py