QUESTION 2Within a few weeks of treatment for herpes virus with the drug isonazide, a patient's herpes virus population consists entirely of isonazide-resistant viruses. Howcan this result best be explained?O A. The drug caused the HIV RNA genome to changeO B. The isonazide drug spontaeously converted to a form ineffective against the virus.O C HIV began making drug-resistant versions of reverse transcriptase (a viral enzyme) in response to the drugO D. None of the above

Herpes simplex virus is divided into two types as: herpes simplex virus-1 and herpes simplex…

Within a few weeks of treatment for herpes virus with the drug isonazide, a patient's herpes virus population consists entirely of isonazide-resistant viruses. How can this result best be explained? O A. The drug caused the HIV RNA genome to change B. The isonazide drug spontaeously converted to a form ineffective against the virus. OC. HIV began making drug-resistant versions of reverse transcriptase (a viral enzyme) in response to the drug OD. None of the above

Within a few weeks of treatment for herpes virus with the drug isonazide, a patient's herpes virus population consists entirely of isonazide-resistant viruses. How can this result best be explained? O A. The drug caused the HIV RNA genome to change B. The isonazide drug spontaeously converted to a form ineffective against the virus. OC. HIV began making drug-resistant versions of reverse transcriptase (a viral enzyme) in response to the drug OD. None of the above

Essentials Of Human Development

1st Edition

ISBN:9781285647357

Author:Kail

Publisher:Kail

Chapter4: The Emergence Of Thought And Language: Cognitive Development In Infancy And Early Childhood

Section4.1: The Onset Of Thinking

Problem 9TY

See similar textbooks

Similar questions

Question 1. Genetic analysis of the viral population in any host infected with any RNA viruses indicates the presence of a.Identical viral clones b.Viral quasi-species c.Both statements are correct d. Both statements are incorrect
Question 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.
Question 15 When comparing replication of "naked" viruses" and enveloped viruses, which process occurs in replication of enveloped viruses which does not occur in replication of naked viruses? O"stealing" of host cell membranes after modification with viral proteins O biosynthesis O entry O assembly O attachment/adsorption Question 16 Bacteriophage Iytic Renlication Cclo
QUESTION 8 What is the function of the amp' gene in a vector? A. It is a restriction enzyme recognition site.. B. It is a selectable marker. O C. It is the origin of replication. O D. It makes the enzyme ß-galactosidase if it is intact, indicating vectors without inserts. O E. It is required for packing into viral shells
Question 2 The discovery of the DNA structure started the modern era of biotechnology. A) True B False
QUESTION 9 which one of these is not required for performing PCR OA template O B. DNA bases OC Reverse transcriptase O D. Primers O D. DNa polymerase
This is question 34, chapter 7, Hartwell Glenetics 6th textbook. I do not know how to answer parts b and c
Give explanation of correct answer and explanation of incorrect answers please and get like otherwise dislike. Hand written solutions are strictly prohibited.
(a) Answer all sections (i)- (Iv). Below is given the structure of three anti-HIV drugs: OH Meo. OMe NH Ph Nevirapine Atazanavir Staudivine (i) Give the drug target and discuss the anti-HIV mechanism of each of these drugs. Vaccines are an attractive prophylactic treatment against both viral and bacterial diseases. A number of glycaconjugate vaccines using bacterial polysaccharide structures conjugated to protein carriers have been introduced into mass vaccination schemes with excellent results. What differences are there in the immune response to a glycoconjugate vaccine as compared to a polysaccharide vaccine? These glycoconjugate va nes has been used for 30 years without any change in their structures, while the composition of the flu vaccine, based on attenuated or killed virus particies, is changed from year to year. Discuss the reason behind this. (iv) Discuss why it has not been possible to develop a (part structure) vaccine against the HIV virus, based on either I) viral…
If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.g
QUESTION 2 Correctly match the material/supply to its role (job) in genetic engineering. - v cuts gene and recipient DNA leaving sticky ends A. restriction enzyme v moves newly combined DNA from a test tube into the organism B. host - v living thing that gets a new gene and therefore a new trait C. vector |- vglues the new gene and recipient DNA together D. DNA ligase
Question 1 Why have the majority of viruses evolved to bind to a host surface receptor that serves an essential function in the host cell? This is completely accidental. These host receptors are poorly protected by the adaptive immune system, making them an easy target for the virus. O Because proteins that perform essential functions are located only on the surface of the host cell. O Host surface receptors that are essential for the host will always be expressed and present on the host.