Answered: Which steps in eukaryotic translation…

Name: Which steps in eukaryotic translation require the cleavage of a phosph
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP? Choose one or more: A. release of EF–Tu B. formation of a peptide bond C. formation of the 80S ribosome D. release of the new polypeptide chain E. transloca

Science

Biology

Which steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
Before the next elongation cycle can take place at a ribosome, the peptide chain of the peptidyl-tRNA has to be transferred to the ___ site and the deacylated tRNA has to move to the ___site. Question 46 options: A, P P, A A, E P, E there is no peptidyl transfer happening during protein translation
Which steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP? Choose one or more: A. release of EF–Tu B. formation of a peptide bond C. formation of the 80S ribosome D. release of the new polypeptide chain E. translocation of the ribosome along the mRNA
Find the events from prokaryotic translation from the list below and list them below in order, by letter, from earliest to latest during translation A. Incoming tRNA occupies the A-site B. Small ribosome binds to Shine Dalgarno sequence C. 5’ methyl cap binds small ribosome D. Large ribosome subunit binds the small ribosome subunit E. P-site tRNA peptide is attached to the amino acid of the A-site tRNA. F. f-Met tRNA binds to P site G. Small ribosomal subunit binds mRNA H. Peptide released from complex.
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation ⚫ Which position shows the "A" position? middle (contains blue tRNA) . Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the end of the anticodon? the C CUAGAC AGAUCUGCUACUAGUAACACGU
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C U! UCUGCUACUAGUAACACGU
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞU
What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2. Binding of large ribosomal subunit to mRNA 3. Binding of small ribosomal subunit to mRNA 4. Binding of tRNA with 2nd amino acid to the A site 5. Formation of covalent bond between methionine and second amino acid A) 1, 2, 3, 4, 5 B) 3, 1, 2, 4, 5 C) 1, 3, 2, 4, 5 D) 2, 3, 1, 4, 5 E) 3, 2, 1, 4, 5
A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'- AUGAAAAAAAAAAAAUAA-3' has the following effect: the only product made is a Met-Lys dipeptide that remains attached to the ribosome. What is the most likely way in which the poison acts to inhibit protein synthesis? It mimics a methionine tRNA. O It inhibits stop proteins from entering the ribosome O It inhibits movement of translocation so it can't empty the P-site O It inhibits the P site from accepting a tRNA to begin with
Using the given information, determine the correct order of the following events during translation: TRNA-methionine is cleaved and moves the empty tRNA to E site & is released, TRNA with polypeptide chain moves to P site. Second tRNA binds to 1. Step 1 codon in A site 2. Step 2 Ribosome arrives at stop codon & polypeptide chain is released from TRNA 3. Step 3 4. Step 4 A peptide bond is created between the first amino acid and the second amino 5. Step 5 acid. 6. Step 6 TRNA-methionine binds to the start codon and the large ribosomal unit binds Small subunit scans MRNA until it reaches start codon
Put the following events of elongation in prokaryotic translation in chronological order. 1. Binding of mRNA with small ribosomal subunit 2. Recognition of initiation codon 3. Complementary base pairing between initiator codon and anticodon of initiator tRNA 4. Base pairing of the mRNA codon following the initiator codon with its complementary tRNA 5. Attachment of the large subunit 2, 1, 4, 3, 5 5, 4, 3, 2, 1 1, 2, 3, 5, 4 1, 2, 3, 4, 5