Which of the following named reduced coenzyme Select one: O a. NAD O b. FAD O c. ATP O d. NADH2
Q: A. Lysine: Polar basic: Calcium absorption B. Proline: Nonpolar imino acid: Protein synthesis C.…
A: A. Lysine is basic, has R group that is significantly positively charged at pH 7. It has second…
Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: what is the importance of studying the variety, sequences, and amounts of mRNA produced in the cell?
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all of…
Q: What is the role of the prep phase in glycolysis? To convert G3P molecules into pyruvate and produce…
A: In glycolysis, the glucose molecules are broken down into two molecules of pyruvate along with the…
Q: When mixes with benedict's solution test tube A 4 amylase and starch will have what color and why
A: Amylase is an enzyme that helps to digest food. Most of our amylase is made in the pancreas and…
Q: Failed to follow
A: Waxes are a broad category of organic compounds that are lipophilic and bendable solids at room…
Q: The glycerol-3-phosphate shuttle can transport cytosolic NADH equivalents into the mitochondrial…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Question 12 C17H29COOH O linolenic acid O non-saponifiable O w-3 fatty acid O All are correct
A: C17H29COOH - It has double bonds at 9, 12, 15th carbon position
Q: N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the B antigen?…
A: Antigens and antibody combination help in determination of blood type. Antigen B binds to antibodies…
Q: Give the names of the 20 Common Amino Acids and draw the structure of each.
A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Reaction catalyzed by Pyruvate carboxylase is given below; Pyruvate + CO2 + ATP + H2O →Pyruvate…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: How does a protein form?
A: Proteins are the heteropolymers of twenty standard amino acids attached together via peptide bonds.…
Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of…
A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold…
Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…
A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…
Q: Estimate the charge on albumin in blood (pH 7.4). The sequence composition of albumin iş listed…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the following statements is CORRECT regarding the following intermediate? H2N H NH2
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…
A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Pyruvate carboxylase (PC) is a ligase class enzyme which catalyze the irreversible carboxylation of…
Q: Question 23 18:1cA9 O w-9 fatty acid O oleic acid
A: Polyunsaturated fats, such as omega-3 fatty acids, are a form of fat that body cannot produce.…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Allosteric enzymes are…
Q: Which of the following contain statements that are both correct? Aspartame triggers the…
A: Aspartame is an artificial sweetener. It first binds and activate a GPCR. The G-alpha bound to GTP ,…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: During DNA replication, the double stranded DNA molecules are separated into single strands and…
Q: Explain when "formulated media" was chosen to be used as a medium in the fermentation process?…
A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid that is used to…
Q: Starting from the O2 binding equilibrium of human hemoglobin written below, derive the Hb + nO2 2…
A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a non-covalent…
Q: They are related in str They have identical ba C) they are the result of a
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Among the simplest_ , those called_, are glucose (an_) and _(a _).
A: Glucose is simple sugar which is present in body having molecular formula C6H12O6.Glucose is…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells…
Q: one more example of chemical (besides acids and alkalis) which can also affect DNA stability.…
A: DNA can be denatured by process of separating dsDNA into single strands, factors like temperature,…
Q: The herbicide glyphosate (Roundup®) kills plants. Discuss all the Biochemistry involved as to why…
A: Herbicides are the chemicals used to kill unwanted species of plants growing around the…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: 3. Based on the name of the following hypothetical drug salts, which of the following statements is…
A: The given options of hypothetical drug can be described as below in terms of acid and base:…
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA…
A: B. Minisatellites - Micro- and mini-satellites, as well as satellite DNA sequences, account for…
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which…
Q: Gluconeogenesis in the liver is When blood glucose levels are low, glucagon is secreted from the…
A: Blood is defined as the type of constant circulating fluid that play a major role in carrying…
Q: Question 8 O alpa-palmitoyl-beta-stearoyl-alpha-oleoyl glycerol O…
A: Triacylglycerols (TAGs) are the stored form of lipids, which are composed of three fatty acids and a…
Q: Compare and contrast the de novo synthesis of purine and pyrimidine ribonucleotides. Move each…
A: There are two biosynthetic pathways for the synthesis of nucleotides: De novo pathway: The bases are…
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial…
A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the…
Q: What is the terminal electron acceptor in photo- phosphorylation?
A: By activating PSII, photophosphorylation converts ADP into ATP using the energy of sunlight. It…
Q: Which of the following is a property of an enzyme? * (Please choose one correct answer only)…
A: Enzymes are the biological catalysts that mediate biochemical reactions by decreasing their…
Q: Question 8 Which of the following glycosidic linkages is hydrolyzed by the a-amylase? O a(1,2) O…
A: Amylase:- enzyme that hydrolyse starch.
Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: Rory’s father was working on the electrical wiring his basement. Rory noticed that his father wore…
A: Rory's father was wearing rubber gloves, which are known to be one of the defense mechanisms while…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: 2. Which of the following macro-molecule can be most structurally diverse among this living world?…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins…
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Calculate the standard free-energy change, deltaG°, for the reaction in which acetaldehyde is…
A: Standard free energy of biochemical reaction is related to standard reduction potential ∆Go = -nFEo…
Q: For the ion concentrations in Table 12.1, calculate the equilibriumpotentials for each ion species…
A: ions can move in either direction through a channel (i.e., either into or out of the cell) the…
![Which of the following named reduced coenzyme
Select one:
a.
NAD
О b. FAD
О с. АТР
O d. NADH2](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F821cdd37-7b10-46ea-843a-fb458d724046%2Fb1214bf2-e035-44af-9207-1ce385f88ec8%2Fs91kes_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Describe the function implied by the name of each of thefollowing enzymes:a. Citrate decarboxylaseb. Adenosine diphosphate phosphorylasec. Oxalate reductased. Nitrite oxidasee. cis-trans IsomeraseDefine the following terms: a. sdLDL b. oxLDL c. cytochrome P450 d. atheroma e. abetalipoproteinemiaDefine the following terms:a. cytochromeb. glycerol phosphate shuttlec. malate-aspartate shuttled. uncoupling proteine. oligomycin
- The small intestine catabolizes amino acids, producing signifi cant amounts of NH4+. Describe the metabolic fate of the NH4+.The source of the nitrogen during serine synthesis is A. glutamate B. NH4+ C. NO2 D. α-ketoglutarateDefine the following terms: a. thiolytic cleavage b. ketogenesis c. ketone bodies d. α-oxidation e. ACC
- A marker enzyme used to identify liver microsomes (ER fragments) after centrifugation is a. AMPK b. phosphodiesterase c. peroxidase d. glucose-6-phosphataseA hydrophilic drug A.Has a high reabsorption in renal tubules B.Has a low ability to penetraye the cell membrane C.Can cross the blood brain barrier easily D.Can bind to intracellular receptors. 2.The phase 1 reaction most often performed by mixed function CYP450 hepatic microsomal enzyme is A.Glucuronidation B.Oxidation C.Reduction D.Acetylation 3.CYP1A2 is involved in the metabolizing of several clinically important xenobiotics such as A.Caffeine B.Morphine C.Aspirin D.Alcohol 4.Drug metabolism,the drug.......undergoes phase 2(acetylation)before undergoing phase 1 (hydrolysis) metabolic reactions A Aspirin B.Codeine C.Isoniazid D.Diazepam E.Phenytoin 5.Which of the following statements is/are true regarding the oxidation of aromatic rings A.Electron donating substituents promote oxidationat the meta position B.Electron withdrawing substituents promote oxidation at the meta position C.All aromatic rings in a molecule are hydroxylated D Monosubstituted aromatic rings can be…ASAP
- D-Gluconic acid is formed from D-Glucoge Select one: a. By reduction b. By oxydation c. By substituton d. By esterificationWhich of these statements about lactate dehydrogenase is true? a.It is a protein. b.It oxidizes lactic acid. c.It reduces another molecule (pyruvic acid). d.All of these are true.Glutamine synthase has how many subunits? A、8 B、10 C、6 D、12