Which of the following correctly describes the flow of electrons during photosynthesis? Select one: a. water, PS II, PS I, sugars b. glucose, water, O2, PSII c. water, sugars, PS I, PSII d. CO2, water, glucose, PSI e. water, PS I, PS II, sugars

Which of the following correctly describes the flow of electrons during photosynthesis? Select one: a. water, PS II, PS I, sugars b. glucose, water, O2, PSII c. water, sugars, PS I, PSII d. CO2, water, glucose, PSI e. water, PS I, PS II, sugars

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter8: Photosynthesis

Section: Chapter Questions

Problem 3VCQ: Figure 8.18 Which of the following statements is true? In photosynthesis, oxygen, carbon dioxide,...

See similar textbooks

Related questions

Q: Which of the following statements is false? a. Gradual speciation is most likely to occur in a…

A: Introduction Speciation is the process of the formation of new species from existing species. It is…

Q: Ch 27 – Prokaryotes – Bacteria and Archaea Difference between prokaryotes and eukaryotes. List the…

A: Bacteria and archaea are two groups of microorganisms that belong to the domain of prokaryotes. Both…

Q: How many net atp are generated if aerobic respiration follows glycolysis? Which type of selection…

A: Introduction :- Glycolysis is the metabolic pathway in which glucose (a sugar molecule) is converted…

Q: Explain how evolution of organisms/ populations occurs as a step by step process (use bullet points…

A: Evolution is a process in which populations of organisms change over time as a result of genetic…

Q: The differentiate between the axial and appendicular skeletons and explan their functions

A: Introduction :- The axial skeleton consists of 80 bones and forms the central axis of the human…

Q: Regarding the Global Reporting Initiative (GRI) GRI-G4 Guidelines, what are the indicators related…

A: Introduction Health is a state of complete physical, mental, and social well-being and not merely…

Q: Why might a soil bacteria (Azotobacter) have the ability to fluoresce? How does fluorescence differ…

A: Soil bacteria are microorganisms that live in soil and play critical roles in a variety of soil…

Q: Y ΝΑ XIW Hfr NA Nutrient Agar Provides all nutrients the bacteria needs + no antibiotics y ECM XIW…

A: The ECM agar is composed of the minimum nutrients required for the growth of bacterial cells,…

Q: Explain the technical errors that may affect coagulation time.

A: Coagulation is the process of blood clotting, which is a natural mechanism that helps to stop…

Q: You just got a small paper cut on your finger, which bled a little but stopped bleeding in a few…

A: Introduction Hemostasis is the natural physiological process by which the body stops bleeding from…

Q: Subject: Biology Question: Why did the Homoscleromorpha move up from the Order to the Class…

A: Homoscleromorpha is a group of marine sponges that have recently been reclassified from being a…

Q: Almonds are rich in? A) Vitamin C B) Vitamin K C) Vitamin D D) Vitamin E

A: Almonds are a highly valued source of nutrition, widely consumed across the world. They are known…

Q: Which level of protein structure results entirely from hydrogen bonding? secondary primary O…

A: Introduction :- A protein is a large, complex molecule made up of chains of smaller molecules called…

Q: hich mycoses are most deadly to patients? O superficial mycoses O dermatomycoses systemic mycoses…

A: Mycoses is a general term which indicates any type of fungal infection. The infection may be…

Q: Q- After placing fruit-fly traps that humanely kill fruit flies around the building, the population…

A: Introduction :- Evolutionary mechanisms are the processes that drive evolution, leading to changes…

Q: What physical and chemical methods could break the chain of infection?

A: Introduction : The spread of an infection throughout a community occurs in a series of connected…

Q: Your friend and you go to Central America for spring break where you have a great time (from what…

A: Introduction :- Sickle-cell anemia is an inherited blood disorder that is caused by a genetic…

Q: Rate of product formation Maximum speed of reaction Catalyzed reaction Uncatalyzed reaction…

A: Introduction :- A substrate is a molecule that an enzyme acts upon, typically by binding to the…

Q: Please label the following: (A) INITIATION *Complementary strand *Template Strand *RNA polymerase…

A: The transcription process is shown in the following diagram. Where DNA is transcribed into RNA with…

Q: Haemoglobin... A. Consists of one or more globin proteins, each with a copper-containing heme group…

A: Hemoglobin is a protein found in red blood cells that is responsible for transporting oxygen from…

Q: Which of the following is an example of gross motor development? picking up a piece of cereal…

A: Gross motor development: The talents that are often learned during childhood as part of a child's…

Q: When a friend falls to the floor after drinking too much alcohol the organelle that will best help…

A: Lysosomes are the organelles which contains enzymes that can break down all proteins and nucleic…

Q: What is the difference between aerobic and anaerobic respiration?

A: Aerobic respiration requires oxygen and produces more ATP (energy) per molecule of glucose than…

Q: B. Labrador retrievers have 3 varieties of fur colour: yellow, chocolate or black. Two genes are…

A: A Punnett square is a simple graphical tool used to predict the probability of different genotypes…

Q: Because of the mechanism of sex determination, males of many species can be neither homozygous nor…

A: * When one or more genes present they will together produces the effects qualitatively which is…

Q: 5. What is the homozygous dominant frequency? 6. What is the heterozygous frequency? 7. What is…

A: The Hardy-Weinberg equilibrium is a theoretical concept that describes how the frequency of alleles…

Q: How close are complement systems to the odometer on a bicycle, and what key distinctions exist…

A: The complement system is a complex set of proteins and pathways in the immune system that helps to…

Q: Explain well the principle behind the streak plate method.

A: In microbiology, there are two types of cultures, pure culture and mixed culture. In pure culture,…

Q: Which of the following conclusions are MOST likely to be supported by genetic evidence? A. Some…

A: Introduction Genetics is the study of heredity, the process by which traits are passed from one…

Q: ENZYMES CLASSIFICATION 1. OXIDOREDUCTASES 2. TRANSFERASES 3. HYDROLASES 4. LYASES 5. ISOMERASES 6.…

A: Based on their characteristics, roles, and structures, enzymes are divided into various groups. The…

Q: 51. The OH concentration of a solution is 4.3 × 10-¹0 M. What is the pH? A) -9.37 B) 9.37 C) -4.63…

A: The pH scale is used to define the acidity or basicity of an aqueous solution. pH has historically…

Q: The presence of more than two alternative forms of a given gene would be called alternation of…

A: Genes Because they are made of DNA, genes are functional units of heredity. The chromosome is made…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: Explain excitation and inhibition with opioid use

A: Introduction Opioids are a class of drugs that interact with specific receptors in the brain and…

Q: Which one of the following traits is not shared by most model species? A. High fecundity B. Short…

A: Introduction Development refers to the process by which a living organism grows and changes over…

Q: Why is an enzyme highly specific for the type of reaction it will promote

A: Enzymes are usually proteins that catalyzes a particular type of reaction by themselves not being…

Q: What are steroids? Give examples of steroids What are waxes? What are the subunit / monomer of…

A: Biomolecules: An organism's molecules that are necessary for one or more usually biological…

Q: Describe how HpaII and MspI can be used to determine if a given DNA sequence is methylated. Any…

A: HpaII and MspI are two useful enzymes used to detect methylation in a given DNA sequence. These…

Q: 8. Which method can separate different cell structures from each other in a biology lab? A)…

A: Introduction Cell structures are the different components that make up a cell. Cells are the basic…

Q: A red flower(WW) and white flower(ww) (P1) have the ability to create pink flowers in thier…

A: Introduction :- Incomplete dominance is a type of genetic interaction in which the phenotype of the…

Q: What are the parts of an amino acid? How does a polypeptide chain form? How is it broken down? Why…

A: Introduction Proteins are made of long chains of smaller subunits called amino acids. There are 20…

Q: Ch 5 – Biomolecules What are monosaccharides, disaccharides and polysaccharides? Give examples of…

A: Carbohydrates are classified into three main types: monosaccharides (simple sugars), disaccharides…

Q: One characteristic of enzyme competitive inhibition is that it results in an increase in the Km of…

A: Proteins called enzymes aid in accelerating chemical processes in human bodies. For several…

Q: What is the most abundant dissolved gas in the blood? Group of answer choices Nitrogen Oxygen Carbon…

A: There are several gases present in blood, including: Oxygen (O2) - The most abundant gas in the…

Q: discuss the cellular senescence, DNA damage and chronicn inflammation, in regards to effects of…

A: Introduction Aging is a natural biological process that involves the progressive decline of various…

Q: Which organelle has more than one layer (state how many layers) of membrane? List the 3 types of…

A: Cell: Biology's branch of cell biology, often known as cellular biology or cytology, focuses on the…

Q: What is the biological function of SOS in plants? Select one: a. it is a calcium antiporter b. it is…

A: SOS stands for the Salt Overly Sensitive (SOS) regulated by genes such as (SOS1-SOS3). Studies of…

Q: Why should air bubbles be avoided in the preparation of fecal smears?

A: In a fecal smear test, a thin layer of feces is put on a microscope slide and then stained to see…

Q: The adrenal medulla secretes: a) more norepinephrine than epinephrine b) only epinephrine c) more…

A: Introduction :- The adrenal medulla is part of the adrenal glands, which are located near the…

Q: Which of the following is a derived trait of chordates?

A: Chordata is belong to the kingdom Animalia and include all vertebrates.

Concept explainers

Photosynthesis

Plants have a capacity that we humans can only imagine— the ability to produce food from sunlight. Sure, we can prepare some dishes that we can savor on, but it become possible because of the plants (as they serve as a producers of all the raw materials required). Photosynthesis is the method of assembling carbohydrates with the aid of sunlight.

Question

Which of the following correctly describes the flow of electrons during photosynthesis?

Select one:

water, PS II, PS I, sugars

glucose, water, O2, PSII

water, sugars, PS I, PSII

CO2, water, glucose, PSI

water, PS I, PS II, sugars

Expert Solution

Step 1

The options in this question include photosystem I and II both of them are present in non cyclinc electron flow.

Here, the photons from sunlight splits water into hydrogen and oxygen releasing 2 electrons.

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A botanist has been examining three plants, measuring the amount of acid in their cells and examining sections of their leaves under the microscope. Numbers in the table are in relative units. Plant Acid, day Acid, night Has wreath anatomy? FADH2 Ethanol A 20 250 No 0 50 B 10 10 No 100 1 C 200 10 Yes 100 1 Part A: Identify the kind of photosynthesis being done by each plant. Explain how enzymes contribute to this data. Part B: Decipher the origin of each plant if one is from the Mojave Desert, one is from a sand dune in Florida, and one is from Minnesota, and explain how you deciphered this.
In photosynthesis, Select one: O a. CO2 is split to create NADPH b. water is made to create NADP c. O2 is an electron acceptor Od. CO2 is split to send electrons through the ETC water is split to send electrons through the ETC
Which of the following is true of chloroplastic ATP: Select one: a. it is made in the Calvin cycle and consumed in the light reactions b. it is used during photosynthesis, S assimilation, and N assimilation c. it does not leave the chloroplast, and is used to breakdown molecules d. it is made during photosynthesis and S assimilation e. it leaves the chloroplast, and is consumed in respiration and N assimilation
Which of the following statements about the light reactions of photosynthesis are correct? 1. Pigments absorb light energy, which excites electrons. 2. The energy of the sun is captured as potential energy. 3. Water molecules split, providing a source of electrons. 4. None of the above 5. All of the above
Which of the following is the correct statement about photosynthesis? water is reduced to become glucose O carbon dioxide is reduced to become glucose water is reduced to become oxygen carbon dioxide is reduced to become oxygen # $ 回 a hp
Define the following terms:a. photosynthesisb. photosystemc. reaction centerd. PSIe. PSII
Which of the following does not occur in photosynthesis?a. reduction of CO2b. oxidation of waterc. reduction of oxygend. All of these are correct
Which of the following is produced during the light reactions of photosynthesis? C6H12O6 CO2 O2 ADP
The process of photosynthesis can be modeled in various ways. For example, a chemical equation is one way to represent photosynthesis. 6CO, + 6H,0 ++ +→ 60, + C,H,,O,
A botanist has been examining three plants, measuring the amount of acid in their cells and examining sections of their leaves under the microscope. Numbers in the table are in relative units. Has wreath Plant Acid, day Acid, night FADH2 Ethanol anatomy? A 20 250 No 50 10 10 No 100 1 C 200 10 Yes 100 1 Part A: Identify the kind of photosynthesis being done by each plant. Explain how enzymes contribute to this data. Part B: Decipher the origin of each plant if one is from the Mojave Desert, one is from a sand dune in Florida, and one is from Minnesota, and explain how you deciphered this. BIU E E nswered 13 tv 吕0 F3 000 F2 F4
To understand photosynthesis, it is important to first understand the larger picture of what molecules the cell uses and generates and how the different molecules cycle between different reactions. The diagram shows a broad overview of the two stages of photosynthesis. Select the label that best corresponds to the lettered blanks in the diagram below. The parentheses represent the choices for each label on the graph. A. (ADP, ATP, O2, Co2) B. (NADPH, Sugars, NADP+, Sunlight) C. (H2O, Sugars, O2, Co2) D. (Sugars, Co2, O2)
Which of the following are reactants of the light reactions of photosynthesis. A. Glucose B. Water C. ATP D. NADP E. Light energy F. NADPH G. Carbon dioxide H. Oxygen