Which layer is absent in the female urethral wall? Select All that apply.An adventitiaA serosaA mucosaA muscularisE) A submucosaK First Previous

Introduction The female urethra is a basic tube structure that serves just to transport urine from…

Answered: Which layer is absent in the female…

Which layer is absent in the female urethral wall? Select All that apply. A An adventitia A serosa C) A mucosa D) A muscularis E) A submucosa

Basic Clinical Laboratory Techniques 6E

6th Edition

ISBN:9781133893943

Author:ESTRIDGE

Publisher:ESTRIDGE

Chapter5: Urinalysis

Section5.1: Introduction To Urinalysis

Problem 13RQ

See similar textbooks

Related questions

Q: principle of a plant virus that transmits through an animal vector

A: A virus is a small microscopic infectious microbe that is non-living until and unless it finds a…

Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…

A: 2 deoxyglucose is analogous to glucose but its hydroxyl group reduce in hydrogen thats why it's not…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Certain cells in the retina respond differently to the direction in which objects move. To…

A: A retinal ganglion cell (RGC) :- is a kind of neuron which is found near the inner surface of the…

Q: AN

A: Male toad

Q: type Kinase A activates mitosis type CDKI inactivates mitosis type Kinase A can inactivate CDKi…

A: Cell cycle consists of following phases S, G1, G2 and M phase. All these phases are related with the…

Q: In case of a plant virus going viral, what actions do you think should be made to improve our food…

Q: Give a specific example on how to use UV-Vis spectrophotometer in Cosmetic Science. Provide a…

A: The UV/Vis spectrophotometer is thermo Scientific Multiskan SkyHigh Microplate Spectrophotometer.…

Q: Discuss the physical structure of either a forest or a lake, and explain how the physical structure…

A: Lake is an open body of shallow depression containing water usually freshwater. Different types of…

Q: Analysis of urine is routinely used in medical screening. The presence of glucose in the urine is…

A: In a healthy person the kidney excretes waste materials of body . Kidneys don't excrete essential…

Q: Viruses cannot reproduce on their own, without the help of a living cell. Explain the basics of how…

A: A virus is an acellular nucleoprotein entity which is able to utilize the synthetic machinery of a…

Q: What are the two important parts of Meromyosin protein?

A: Introduction - Myosin contains a component called meromyosin (mero meaning "part of"). Myosin and…

Q: Gene A encodes for a protein A which prevents exit from the G1 phase of the cell cycle. You are…

A: Cancer is the uncontrolled cell division that is highly under the control of genes. Cell cycle is a…

Q: A loss of function mutation in both alleles of the Bcl2 gene A loss-of-function mutation in both…

A: For the cell to evade apoptotic pathways, they need to get rid of things which kill the cell as is…

Q: What random act of kindness toward strangers would you do? Do you think you will carry out the act…

A: Random acts of kindness can lift up anyone’s spirits, and you hold the power to make someone’s day…

Q: What is the relationship between the amount of sodium ions in the blood and nephron function, urine…

A: Introduction Sodium is an electrolyte, which are minerals that the body need in relatively large…

Q: Primer Development Pick your favorite gene and develop primers for a target within the gene. Provide…

A: PCR primers are short pieces of single-stranded DNA, usually around 20 nucleotides in length. Two…

Q: What is the significance of Juxtaglomerular apparatus in kidney function.

A: Introduction - The kidneys are two bean-shaped organs located on either side of your spine, below…

Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.

A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…

Q: Which of the following is an environmental factor that leads to food insecurity? a) Poverty b)…

A: Food insecurity defines the conditions when there is an inadequate amount of food they consume (in…

Q: Which of the following regarding aldosterone is false? the process leading to its release begin with…

A: The option 1 is correct as renin begins the cleavage of angiotensinogen to form angiotensin II. This…

Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…

A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…

Q: explain in not more than 5 sentences the priciple in the machine, PLATELET AGGREGOMETER.

A: Platelets These are small cell fragments that are involved in the repairing of wound and clotting of…

Q: Name five (5) common, popular, familiar Philippine plants that are used as ingredients in cosmetics.…

Q: The proteins work together to cause the release of the transcription factor that is bound by the…

A: Answer is D p53

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: DNA is the store house of genetic information. This information is transferred to mRNA through the…

Q: Give economic and ecological significance of Corn (Zea)

A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…

Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: mystery compound, compound B. You add it to the dish with your hippocampal circuit. You fire the…

A: EPSP is excitatory post synaptic potential which is initiated by the movement of positively charge…

Q: If a person has one gene influencing blue eyes but actually has brown eyes, blue eyes must be a…

A: Introduction :- When two or more genes control the same trait, it is known as polygenic inheritance.…

Q: MULTIPLE CHOICE. A B C D or Duhh 1) Molecules assisted by a transport protein may cross a selective…

A: Introduction :- Active transport is the movement of molecules across a cell membrane against a…

Q: The current estimate is that mammalian B cells are capable of producing 1,010 different…

A: Immunoglobulins are composed of four polypeptide chains out of which two are heavy chains and two…

Q: What are nutritional disorders

A: Introduction :- Any nutrient-related disease or condition that causes illness in humans is referred…

Q: A carton of milk, under the right conditions, will undergo ___ type of succession.

A: Introduction Succession:- It is the change in either species composition, structure, or architecture…

Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…

A: Mimicry and warning coloration are general forms of defensive nature exhibited by organisms.…

Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…

A: Mimicry refers to the superficial resemblance of two or more organisms that are not closely related.…

Q: How does the brain control inspiration and expiration

A: INTRODUCTION The flow of air through the conducting passageways between the atmosphere and the lungs…

Q: Pyruvate kinase, a glycolysis enzyme

Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…

A: Ans... a base substitution in an enhancer region

Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…

A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…

Q: List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species…

Q: To completely unfold a globular protein, use both A denaturant and reducing agent b smooth…

A: Spherical ("globe-like") proteins, also known as globular proteins or spheroproteins, are one of the…

Q: Short Answer 1. A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in…

A: The independent assortment of genes states that the alleles of different genes are assortment…

Q: s it possible to stop animal testing?

A: The use of animals other than humans in experiments for study and research is referred to as animal…

Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…

A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…

Q: What is the history of birth rates?

A: The birth rate is also relatable to the term referred to as Natality. The birth rate is defined as a…

Q: Which parts of the body are involved in thermoregulation? (Check all that apply) Skin Stomach…

A: Various physical processes help the human body maintain a temperature of around 98.6°F (37°C).…

Q: estrogen receptor (ER)-positive or -negative.

A: Cancer : The condition where the cells in a specific part of the body grow and reproduce…

Q: Complete the table. Calculate the size of a theoretical population of E. Coli, if given unlimited…

A: The generation time of the given bacteria Escherichia coli is 20 minutes. This means that every 20…

Q: 1. For the complete metabolism of 2 glyceraldehyde 3-phosphate molecules through glycolysis,…

A: Glycolysis is the process in which one mole of glucose is partially oxidized into two moles of…

Question

Which layer is absent in the female urethral wall? Select All that apply.
An adventitia
A serosa
A mucosa
A muscularis
E) A submucosa
K First Previous

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

These are parts of the male urethra except: O Seminal Prostatic Spongy Membranous O Penile
A 75 year old man comes to the physician because of a six-week history of poor urinary stream and inability to void completely. Physical examination shows a markedly enlarged prostate. The diagnosis of benign prostatic hyperplasia is made. Between which of the following regions of the urethra is obstruction of urine flow most likely located in this patient? The bladder neck and the membranous urethra The membranous urethra and the proximal bulb of the penis The peritoneal membrane and the levator ani The proximal bulb of the penis and the perineal membrane The trigone and the internal urethral orifice
Hypospadias is a birth defect in which the external urethral office does not appear at the tip of the penis, but somewhere on the underside of the penis. Discuss one urinary complication of having this defect and one reproductive complication of having this defect.
Write the name of the structure that the phrase.Last section of urethra located in penis
Of the following structures, conditions, or procedures, designate by matching the term in the left column to male, female, or both ovum orifice ureter cystoscopy urethra prepuce nephrolithiasis salpinx urology amenorrhea IVP lithrotripsy corpus hydrocele cul-de-sac cystocele areola orchiectomy hysterectomy testes female both both both both male male female both female female male female male female female female male 1 female male > > > V > > > > >
Urinary Bladder Color the following structures in the figure below. Use the colors suggested or choose your own. VII. Detrusor muscle: Pink Ureters: Brown • Urethra: Green • External urinary sphincter: Purple Internal urethral sphincter: Orange Trigone: Blue • Rugae: Outline in black
Title Which of the following statements regarding the urethra is FALSE? a. The female urethra is 3 to 4 cm Description Which of the following statements regarding the urethra is FALSE?</o:p> a. The female urethra is 3 to 4 cm long and transports urine from the body</o:p> b. The male urethra is longer than the female urethra and has a dual function</o:p> c. The internal urethral sphincter is formed by a thickening of the detrusor muscle</o:p> d. The external urethral sphincter is formed of skeletal muscle and is under involuntary control</o:p> </o:p>