Which best describes eutrophication? S leached from soil causes acidification and death of fish ) Too much N leached from soil causes rapid algae growth, followed by algae death, decomposition, and hypoxia Excess N and P from soil contaminates natural water bodies and causes rapid algae growth, followed by algae death, decomposition, and hypoxia ON and P leached from soil reacts with oxygen in water, causing hypoxia Excess N and P from soil contaminates natural water bodies and causes toxic algae blooms that kill fish

Q: How do we know that Intumane theX efromsscmesplay NOROLEIN sex determinationt

A: Sex determination in human being is done on the basis of XX/XY chromosomes.

Q: 33 32 10

A: Respiratory system is a part of body system which is generally involved in exchange of gases . In…

Q: AIDS full form

A: Step 1 Immuno-deficiency diseases are diseases caused by a defect in one or more components of…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: VL Illustrate the given type of epithelium and give at least 2 common locations where it can be…

A: Many cell combined to form tissues . Tissues are divided into :-  A ) Epithelial tissue  B ) Nervous…

Q: Name plz

A: The long narrow and coil part of alimentary system that starts just below the stomach where both…

Q: ABCDE u o I

A: The given diagram shows the female reproductive system and the excretory system in humans. The…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: please clear, true or false

A: The Minnesota Starvation Study, conducted between 1944 and 1945, was a landmark research project…

Q: When part of a nucleotide in a nucleic acid chain, which of the following may base pair with uridine…

A: Uridine is a major form of pyrimidine nucleotide, from which cytosine and uracil are derived. It is…

Q: Diarrhea prefix meaning

A: We know that Medical terminology  Terminology includes a group of words related to subject area. It…

Q: HO H H H. HO OH HO H. H. H. Но H. OH ÓH 1,1 1,2 1,3 1,4 1,5 1,6

A: Introduction: A glycosidic bond is a type of covalent bond that connects a carbohydrate molecule to…

Q: A -D

A: A compound microscope is an upright microscope that uses two sets of lens to enlarge the image of a…

Q: name the feature (blue circle)

A: The skeletal system is one of the 11 major body organ systems that are concerned with various…

Q: O O C

A: Inheritance or heredity is passing on one trait from the parents to the progeny by either asexual or…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: 7

A: The urinary system is responsible for the production, storage, and excretion of urine. Urine is…

Q: 17 STRE

A: Muscles of hand and arm

Q: Identify # 11

A: The cranial nerves are a set of 12 paired nerves that arise directly from the brain. The first two…

Q: Baby monkey favorite food

A: Monkey is a common name that may refer to certain groups or species of the simian mammals of order…

Q: 0

A: The digestive tract starts from the mouth and finishes at the rectum. The digestive system of the…

Q: Br2 COOH CCl4

A: b.

Q: An anastor mosis cah OSIS

A: Any joint between two blood vessels is known as anastomosis.

Q: B A- E- A U D E ✓ B ✓ F- vi G- H F G D- ✓ H-

A: The image is of brain and its different parts. Brain is the most important regulatory organ of the…

Q: 3. 9, 2

A: The diagram represents the lymph node. It is a small swellings in the lymphatic system. The lymph is…

Q: w

A:

Q: Observe the structures above and answer the questions below. Please pay attention to the number of…

A: All these structures given are protein domain or motif structure and is part of many large protein…

Q: I letters

A: Differential stain is used is Gram stain. Gram stain uses two dyes Crystal violet and safranin. It…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: of the following images show a carbohydrate? Note: molecular biologists have many different ways o…

A: Biomolecules are the molecules of life. Small sized biomolecules are called as biomicromolecules.…

Q: 100mL to ul

A:

Q: Name 1 living thing

A: The organisms which are able to grow, reproduce and motile in nature(movement) etc.. are considered…

Q: Can you do the first part

A:

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Questions: 1. Select a discrete colony. Describe the appearance of the colony. 2. Describe the…

A: The study of bacterial cultures is an interesting aspect of microbiology. It includes the cautious…

Q: Listen III Name this tissue. Be specific the lines (or bands) the blue arrows are pointing to. A/ A/…

A: Introduction :- In biology, a tissue is described as a collection of cells that have a same…

Q: Letter D please what is called!

A: The smallest structural and functional unit of an organism is known as cell which contain different…

Substance Abuse

Substance abuse refers to the use of illegal drugs in excessive quantities, as well as the misuse of legal substances such as prescription or over-the-counter pharmaceuticals or alcohol for purposes other than those intended. Drug addiction, also known as substance use disorder, is a disease that affects the brain and behavior of a person. It leads to a failure to control the use of any drug or prescription, legal or illegal.