When an inhibitor blocks a step in electron transport, all of the following are true except that Oa. carriers preceding the inhibitor are in their oxidized form Ob. the cell will die Oc. carriers preceding the inhibitor are in their reduced form Od. ATP synthesis stops

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: I am a bit confused on why you switched the correct and incorrect statements. Could you clarify?

A: In genetics there are two types of alleles that are in charge of imparting the phenotypic effects on…

Q: Gioe beovres die/ge drde or rlaun HG- tikad Alaa ktat Tiwan prdar cal lele steat i Aart atoe…

A: Since we only answer one question at a time, we’ll answer the first one (flow chart). Please…

Q: - G А. В D -K E F. L

A: Cells are the fundamental unit of life, and a number of similar cells together form a tissue that…

Q: can you please label on the image i have provided

A: The nucleus is present within the cell and constitutes chromosomes. Connective tissue is responsible…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: mr k's diagnosis has aphasia and hemiparesis mr k is higher rick for falls what three safety…

A: A language problem called aphasia impairs a person's capacity for efficient communication. It may…

Q: can i have this in more detail please

A: Tinnitus is a common auditory phenomenon characterized by the perception of sound within the absence…

Q: 1) Read the directive posted linked as image. If you were a nursing home director, how would you…

A: A directive was issued by Governor Cuomo on March 25, 2020. telling New York's assisted living…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: I am having trouble with these qustions can you help

A: We are answering all parts of first image . For second  image kindly repost.

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: MEDICAL TERMMAIN ENTRY (pronunciation) MEANING (definition) |1. glycemia |2. hypothalamus 3.…

A: Anatomy is a branch of biology that deals with identifying and characterization of living things'…

Q: need help with a intro to respiratory questions, thanks

A: Respiration is the sequence of process that results in the exchange of oxygen and the carbon dioxide…

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…

A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…

Q: Quantal release can occur spontaneously O True O False

A: Quantal release refers to the neurotransmitter released from the vesicles. This is mainly used for…

Q: 81. Uonsən Match the device with its type. Submitted Answers Prompts Mouse Input device Printer…

A: Your answer to all the subparts is correct. The mouse is an input device. The printer is an output…

Q: Please I need help understand which it is

A: Hormones are chemical compounds that are usually released by endocrine glands of the body and have a…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Listen III Name this tissue. Be specific the lines (or bands) the blue arrows are pointing to. A/ A/…

A: Introduction :- In biology, a tissue is described as a collection of cells that have a same…