What is the volume of a container if 8.98 mol of a gas at 2.88 atm of pressure is at a temperature of 22°C? 75.5 L O 70.9 L 43.2 L 42.5 L 32.4 L
Q: (b) ☐ The exergonic reactions catalyzed by isocitrate dehydrogenase (ICDH) and α- ketoglutarate…
A: Isocitrate Dehydrogenase (ICDH): Function: ICDH plays a crucial role in the TCA cycle by catalyzing…
Q: what was the change in mass of the contents of the crucible? Compare the mass after heating to the…
A: The amount and mass of water evaporated are not necessarily significant but are large enough for a…
Q: Can H₂N-(AA)₂-Cys-(AA)-Lys-(AA)-Cys-(AA)-COOH HOOCCH₂S give by simple oxidation SCH2COOH…
A: The particular reaction in question, involving the formation of SCH2COOH, appears to be chemically…
Q: Draw the major product of the following Heck reaction. MeO Pd(OAc)2 (1 equiv) AcOH 63% Draw the…
A: SOLUTION : EXPLANATION : Oxidative addition occurs in the first step. Pd(0) oxidises itself into…
Q: 1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were…
A: To help you better understand the answers above, here are non-technical explanations of each…
Q: Which of the following factors does not pay for the generation of NADH and ATP during steps 6 and 7…
A: The factor that does not directly contribute to the generation of NADH and ATP during steps 6 and 7…
Q: What does the Michalis-Menten equation tell you? A. The velocity of an enzyme under physiological…
A: Approach to solving the question: Detailed explanation:The Michaelis-Menten equation provides a…
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Q: if each nadh generates 3 atp molecules and each fadh2 generates 2 atp molecules calculate the number…
A: Determine the number of repetitions of the ß-oxidation spiral needed to completely degrade the fatty…
Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH RUES…
A: Data Points and PlottingThe graph I created is a scatter plot that displays values from two…
Q: Another member of your research group studied the kinetics of theGAPDH from the organism. They also…
A: Approach to solving the question: Detailed explanation: Examples: Key references:…
Q: The teal line of the following reaction is representing, PNPP -----> PNP +P (in the presence of…
A: Step 1:The correct answer is :C. Instantaneous rate of the reaction at time zero Here's why:PNPP:…
Q: Estimate the PI of the given amino acid? Assume that the amino acid contains a single carboxylic…
A: Step 1:The isoelectric point (pI) of a molecule, especially in the context of proteins or amino…
Q: ATP synthesis in mitochondria requires all of the following EXCEPT (select two answers) a hydrogen…
A: Solution:The two correct options are:Fermentation of pyruvate into lactate to regenerate NAD+The…
Q: Consider the synthesis of lauric acid (12:0) in a coconut tree, a C3 plant. This will require you to…
A: Coconut trees are mini lauric acid factories• 6 two-carbon building blocks (acetyl-CoA) are…
Q: Mechanism
A: Step 1: To solve the chemical reaction depicted in the image, you would need to apply knowledge of…
Q: The belief that rare mutations within a single cell allow it bypass growth barriers to become…
A: Driver Mutations: These are genetic changes that directly drive growth to cells, allowing them to…
Q: Describe in detail what is meant by a "self- restricted/ self-tolerant" T cell. A diagram is…
A: Approach to solving the question:
Q: What is the chemistry principle behind when (treatment: heavy cream, evaporated milk, and NFDM) is…
A: The behavior of dairy products beneath diverse conditions, including temperature variations and…
Q: In glycolysis, fructose 1,6-bisphosphate is converted to two products with a standard free- energy…
A: under what cellular conditions the free-energy change (ΔG) will be negative, we need to consider the…
Q: Please write it out
A: Detailed Explanation - 1. Hydrolysis of Sucrose (Not in Muscle):Sucrose, a disaccharide, isn't…
Q: Import of fatty acids is used for which of the following? (check all that apply) Group of answer…
A: ANSWER WELL EXPLAINED ABOVE
Q: 14. What is the major organic product obtained from the following reaction? CH3 CH3 Br Br &&& Br2…
A:
Q: Calculate the rate enhancement for the enzyme pair: Enzyme 1: Kcat (sec-1)= 5.5 KM (µ M) = 1245…
A: Enzymes are known to enhance (increase) the rate of a reaction, compared to the rate at which the…
Q: Which statement is true about protein folding? ○ The equilibrium between folded and unfolded states…
A: Please comment down for any doubt. I hope my answer helps you.
Q: help me with part 4 and 5 please
A: The action potential would change in that the resting membrane potential would shift to a more…
Q: (c) (1 ) Fluoroacetate, prepared commercially for rodent control, is also produced by a South Afri-…
A: Let's go ahead and go further into each individual facet, shall we?1. Interrupt the citric acid…
Q: Skeletal muscle cells (myocytes) store energy by synthesizing ____________ when blood sugar is…
A: The correct answer is:glycogen; highWhen blood sugar (glucose) levels are high, skeletal muscle…
Q: The standard reduction potentials for some important cellular compounds are shown below.…
A: The reduction reaction with the highest (most positive) standard reduction potential is the…
Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle) Why would a defect in the liver enzyme…
A: In mammals, fructose-1,6-bisphosphatase (Fbp) has two isotypes: liver and muscle, which are encoded…
Q: (d) Consequently, the complete balanced reaction is D pyruvate + NADH + H+ → acetaldehyde + CO2 +…
A: Step 1: Step 2: Step 3: Step 4:
Q: 2+ The activity of the Ca 2+ -ATPase is regulated reversibly under normal conditions to maintain…
A: To calculate the minimum intracellular calcium concentration ([Ca2+] inside the sarcomere) when the…
Q: Draw the major product of the following Suzuki coupling reaction. CN B(OH)2 CI 2 eq K₂CO₂ aq. 3…
A:
Q: (10) The supplement and nutraceutical industries have grown into a multi-billion dollar market as…
A: References:1. Reginster JY, et al. Efficacy and safety of glucosamine sulfate in the management of…
Q: 4. (2 points) Pseudomonas aeruginosa's circular chromosome is 7.5x106 bp long and the replication…
A: To calculate the time required for Pseudomonas aeruginosa to replicate its genome, we can use the…
Q: What is this TLC's Rf Value
A:
Q: The pyruvate dehydrogenase complex catalyzes the synthesis of acetyl-CoA, a very important molecule…
A: In the process of cellular metabolism, the pyruvate dehydrogenase complex (PDC) is responsible for…
Q: All are principal allosteric regulatory "signals" controlling the TCA cycle activity EXCEPT:…
A: (a). Acetyl-CoA: High levels of acetyl-CoA indicate that the TCA cycle has sufficient fuel, thus…
Q: Consider a cell that requires much more ribose5-phosphate than NADPH. The cell needs ribose…
A: The question is asking about the metabolic fate of glucose 6-phosphate, glycolytic intermediates,…
Q: Natural products are the future of drug discovery. Discuss this statement giving three reasons why…
A: Reasons why natural products are a good source of novel drugs: Chemical Diversity: Natural products…
Q: Which of the following are the reduced (high energy) forms of the electron carriers nicotinamide…
A: NADH2; FADH2: In biochemistry, NADH and FADH2 are the reduced forms of NAD+ and FAD, respectively.…
Q: A compound has a pKa of 7.4. You have made up 100 mL of a 1.0 M solution of this compound at pH 8.0.…
A: To find the ratio of the unprotonated to protonated form of the molecules, we'll use the…
Q: 7. The diffusion constant for the membrane protein fibronectin is approximately 0.7 x 10-12 cm²/sec,…
A: For fibronectin:Dfibronectin = 0.7 x 10-12 cm2/sect = 50 x10-3 secDistance =…
Q: In the situations described below, what is the free energy change if 1 mole of Na+ is transported…
A: The objective of the question is to calculate the free energy change (ΔG) when 1 mole of Na+ ions is…
Q: 9.Shown below are the Hill plots of myoglobin (cyan) and an unknown 02 binding protein (magenta).…
A: a. Does this unknown protein bind to O2 cooperatively? If so, is it a positive or negative…
Q: Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients…
A: The objective of the question is to identify the nutrients present in a meal consisting of rice,…
Q: Which of the disaccharides shown in Figure 9-2 contain(s) two hexoses? Figure 9-2 CH2OH CH2OH OH H H…
A: We need to count the carbon atoms in each monosaccharide unit that constitutes a disaccharide in…
Q: MATCH each of the following terms to a structure from the list below. There is only one correct…
A: Hope you understand...... Please do rate..... Thankyou :) Have a good day ..
Q: None
A: Given mass of the snowboarder (m) = 65 kgangle of inclination (θ) = 13ocoefficient of kinetic…
Q: Predict the product of the following organic reaction: CH₂ CH Ni + 3 H₂ P CH2 Specifically, in the…
A:
Step by step
Solved in 2 steps with 2 images
- A sample of 8.00 mol of gas in a 10.00 L container is at 45.0 °C. What is the pressure (in atm) of the gas?15.0 L of an ideal gas at 298 K and 3.36 atm are heated to 383 K with a new pressure of 6.05 atm. What is the new volume in liters?How many moles of chlorine gas at 120. °C and 33.3 atm would occupy a vessel of 39.0 L?
- A cylinder of gas at room temperature (20 degrees Celsius) has a pressure P1. To what temperature in degrees Celsius would the temperature have to be increased for the pressure to be 1.2p1?An aerosol spray can of deodorant with a volume of 350 mL contains 3.2 g of propane gas (C3H8) as propellant. What is the pressure (in Pa) in the can at 20 °C?How many mg in 1.35 g ? Report your answer to 3 decimal places (examples 1.042, 0.050, 0.198, 3.000).
- A helium gas cylinder of the sort used to fill balloons has a volume of 0.180 m3 and a pressure of 150 X 105 Pa (150 atm) at 298 K (25 °C). How many moles of helium are in the tank? How many grams?What volume in liters would 20.0 moles of sulfur dioxide occupy at 75.3 °C with a pressure of 2.40 atm?How many kilocalories are needed to vaporize 5.8 mol of Br2?
- (a) What is the specific volume of a gas at 1 250 kPaa and 33 C when its density is 0.715 kg/m3 at 101.325 kPaa and 0 C. [3 decimal places] (b) Calculate its gas constant and approximate molecular weight. [whole number]The vapour pressure of water at blood temperature is 47 Torr. What is the partial pressure of dry air in our lungs when the total pressure is 760 Torr?A quantity of gas in a piston cylinder had a volume of 0.539 m^3 and a pressure of 200 Pa. the piston compresses the gas to 0.222 m^3 in an isothermal (constant-temperature) process. What is the final pressure of the gas?