What is the Rf value of each amino acid observed? A mixture of amino acids was subjected to paperchromatography with six amino acid standards in orderto determine its composition. After visualization usingninhydrin, the measured distances were as follows:Distances:FSolvent - 10.3cmXA - 4.5cmB - 1.0cmAC - 6.6cmDED - 3.9cmE - 3.5cmBF - 9.1cmG - 10.3cmX1 - 0.7cmX2 - 4.3cmX3 - 7.1cm

Rf ( retardation factor):- It is defined as the ratio of distance traveled by the centre of a spot (…

Answered: What is the Rf value of each amino acid…

Science

Biochemistry

What is the Rf value of each amino acid observed?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…

A: Purification is a process by which impurities are removed from a sample and desired component is…

Q: How do you identify the N vs C terminals? For the first part of the question, do you then list the…

A: Amino acids are the monomers of a polypeptide or protein. Amino acids contain an amino (-NH2) group…

Q: Write the Structure Activity Relationship ( SAR) of Captopril ?

A: Captopril is an antihypertensive drug and is used for the treatment of renovascular hypertension. It…

Q: In order to prepare a standard curve, you will do serial dilutions of the standard protein. Assume…

A: Serial dilutionsIt refers to the stepwise dilution of a solution to create a series of solutions…

Q: Give the exact location of aminon.

A: Amnion is a type of membrane that surrounds the embryo and works as a shock absorbent to protect the…

Q: proteins are deamidated in an aqueous solution to produce ammonium and aspartate, respectively, from…

A: Isoelectric focusing (IEF), also known as electrofocusing, is a technique for separating different…

Q: using the pKA table, determine the Isoelectric point of Arginine

A: The isoelectric point (pI) is the pH at which the net charge on amino acid is zero. Arginine is an…

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction Organic substances known as amino acids have both functional groups for amino and…

Q: Digestion of a peptide with trypsin generates two smaller peptide products: methionine-glycine and…

A: pepsin is a serine protease that cleaves the bond present in the C-terminal of amino acids Lysine…

Q: In TLC, why are the colors of the peaks for each amino acid are different depending on the types of…

A: TLC stands for Thin Layer Chromatography. It is a refined technique that is used for isolating or…

Q: what are the molecular way to diagnose Lactose intolerance disorder ? describe in detail about…

A: Lactose is the main sugar in milk, which is a disaccharide. It is hydrolyzed by intestinal lactase…

Q: Write the following oligopeptide using the one letter code for the amino acids: Cys-His-lle-Leu-Glu…

A: One letter code has been assigned to each and every amino acids and is often used to represent the…

Q: Which amino acids are in the figure?

A: Amino acids are the building blocks of proteins. They are organic compounds made up of an amino…

Q: What are the 3 steps of amino acid degradation:

A: Amino acids are biomolecules that act as the building blocks of proteins. Biologically important…

Q: 80 20 60 0 60 20

A: It is a way to visualise angles as a function of angles . It is the way we could identify the…

Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: hat is the 21st amino acid? Explain

A: The amino acid is generally 20 in numbers. These amino acid residues are incorporated into the…

Q: What is meant by the binding problem, and what is necessary for binding to occur?

A: "The Binding Problem" is one of the most well-known open questions in computational neuroscience.…

Q: Refer to the following table below to answer the succeeding questions: Protein Isoelectric pH…

A: Two dimensional gel electrophoresis is an electrophoretic technique in which in the first dimension…

Q: What is denaturation? Give examples. What are the factors that affects the proteir synthesis?

A: Proteins are defined as an unbranched polymers which are made up of 22 amino acids. They are usually…

Q: What is denaturation? Give examples. What are the factors that affects the protein synthesis?

A: Protein is macromolecule that is vital for maintaining muscle mass.

Q: glutelins molecular weight

A: Glutelins are a class of propain prolamin proteins found in the endosperm of certain seeds of the…

Q: Suppose that you are tasked to determine the protein concentration of an unknown protein solution…

A: The concentration of unknown protein solution can be determined by plotting a graph between…

Q: Explain the difference between essential and nonessential amino acids. How many of each are there?…

A: Proteins are one of the macronutrients present in the food. They are very essential for growth and…

Q: The PAM1 matrix penalizes mismatching amino acids more than higher numbered PAM matrices. Explain…

A: PAM (POINT ACCEPTED MATRIX) indicates the probability of a mutation of an amino acid in a given…

Q: 1) In MALDI-TOF data, when performing peptide mass mapping search, a) The number of peptides…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: Is there a reason why you divided the pKa's by 2 when determining the pI?

A: Isoelectric pH or pI is the pH at which the amino acid or the peptide is in zwitterion state.…

Q: Intrinsically disordered regions of proteins can be identified using bioinformatic methods to search…

A: Despite the classical structure-function paradigm (which is often visualized because the…

Q: how would you identify whether or not complete resolution of the three amino acids has been achieved

A: An amino group and an acid group-containing organic molecules are called Amino acids. At the point…

Q: You were able to extract an amino acid sequence from an unknown protein you process through mass…

A: An analytical tool that is used for the purpose of measuring the ratio of mass-to-charge, is called:…

Q: You are trying to determine the PTMs on your protein of interest, so you set up a mass spectrometry…

A: The modification of proteins after its biosynthesis is called post-translational modification (PTM).…

Q: What contributes to the asymmetric protein distributions ?

A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…

Q: How do you calculate the pI value of glutamic acid and histidine? What is the importance of…

A: The pI value is the pH at which amino acid has a net charge of zero. It is known as the isoelectric…

Q: What is the biochemical information you acquire from amino acid sequence? Give three examples.

A: A polypeptide is composed of a long chain of amino acids, which are joined through peptide bonds by…

Question

What is the Rf value of each amino acid observed?

A mixture of amino acids was subjected to paper
chromatography with six amino acid standards in order
to determine its composition. After visualization using
ninhydrin, the measured distances were as follows:
Distances:
F
Solvent - 10.3cm
X
A - 4.5cm
B - 1.0cm
A
C - 6.6cm
D
E
D - 3.9cm
E - 3.5cm
B
F - 9.1cm
G - 10.3cm
X1 - 0.7cm
X2 - 4.3cm
X3 - 7.1cm

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Trending now

This is a popular solution!

Step by step

Solved in 5 steps with 4 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

с" CH2 CH2 "НaN H с. CH С" CH Нзс CHз ZI о-о
1a) In MALDI-TOF data, when performing peptide mass mapping search, the number of peptides and the sequence coverage decreases, but protien score increase. Explain b) As the same as part a, the peptide masses and the coverage remain the same, but the protien score increase, explain how this can happen.
The tetrapeptide Cys-Trp-Lys-Pro was digested with chymotrypsin and adjusted to pH=0.5 to fully protonate all digestion products. The digestion products were then applied to a strong cation exchange column (sulfonic acid). The products were eluted from the column using a pH gradient from 0.5 to 13. Write the primary amino acid sequence of the products in the order they would elute from the column. Indicate the pH value at which each product elutes from the column
What is the effect of the altered amino acid sequence in Hb S that causes the cells to form sickle shapes?
What is the pI, and how is it determined for amino acids that have nonionizable R groups?
Are all the proteins separated properly using two-dimensional (2D) gel electrophoresis? Why or why not?
Consider a short peptide with the sequence M-C-Q-L-Y-P-E-D-K. List the ionizable groups in this peptide, and the net charge of the whole peptide at pH a) 1.5, b) 7.0, and c)12.0.
Help
Is there a difference in the effects of different salt solutions on protein denaturation? Why?
What is the pI, and how is it determined for amino acids that have noninionizable R groups?
Discuss the potential difficulties of designing a diet to alleviate the symptoms of phenylketonuria.
Explain the Rf value obtained on the basis of the structure of amino acids use. Explain in 1-3 sentence only.