What is the relationship between genes and DNA? O In sexual reproduction, offspring get their genes from their parents. They get half from mom and half from dad. o Scientists used bacteria and added just one extra gene to it to develop insulin to treat peopl with diabetes. O Genes are specific pieces of DNA that give living things their traits.

Q: In your opinon, what researcher(s) made it possible to understand DNA and how did their scientific…

A: DNA or deoxyribose nucleic acid is a molecule of life. It is a type of nucleic acid.  DNA is a…

Q: Explain why the nucleotide sequence of the same gene that you inherited from your mother and father…

A: we inherit two copies of each chromosome—one copy from your mom and one copy from your dad. This…

Q: Match the statement with the correct reproduction method. * Asexual Reproduction Sexual Reproduction…

A: Asexual reproduction is the simplest form of reproduction in which only one parent is involved which…

Q: A human mother's genes seem to influence brain development while a human father's genes seem to…

A: Answer :  Th correct option would be :  the mother imprints her growth genes and the father imprints…

Q: What percentage of our DNA do you think is the same in all humans

A: The genome is the genetic material of a living organism. It is the set of coded instructions that…

Q: The first gnathostomes evolved about 200 million years ago. This statement is (T/F).

A: Gnathostomes  They are the first jawed animal evolved on the earth. The first jawed animal known to…

Q: The is the foundation of a medical term The comes at the end of a medical term The is attached to…

A:

Q: Which of the following statements about genes is incorrect? Select one: O a. During fertilization,…

A: Genetics helps us understand how traits are inherited. Genetics can help us understand how traits,…

Q: Three of the statements below are true statements and one is false. Select the FALSE statement. New…

A: Genetics describes the study of how traits are inherited. A trait can be defined as a basic…

Q: Why animals help their genetic relatives?

A: Genetics can be defined as the branch of biology which deals with the study of genetic variation,…

Q: DNA duplication is important for O a. Both mitosis and meiosis O b. Only meiosis O c. Neither…

A: A) DNA duplication is important in mitosis because it is a crucial process to assure that mutations…

Q: What life experiences can someone havethat might coil or uncoil your DNA?

A: Epigenetics is an study of effects that environment and behavior have on genes.

Q: Genes come in different versions called _________. What term describes the condition where the two…

A: Gregor Mendel is known as the Father of genetics and he discovered that traits/ characters are…

Q: Vhich of the following is true of BOTH MEIOSIS AND MITOSIS? O Results in two identical diploid…

A: Mitosis is the process by which a single parent cell divides into two daughter cells having the same…

Q: Stem cells in the skin are found in the hypodermis will divide via meiosis to become adult cells…

A: Skin stem cells are found in the adult tissue; self-renewed and differentiated by producing cells of…

Q: The "Central Dogma of Life" states that the pattern of information that occurs most frequently in…

A: Central dogma is the process that occurs in the lifecycle of cell through which information present…

Q: During the development of an animal embryo, different tissue types like muscle and neurons will…

A: As per our honor code, we are authorized to answer only one question at a moment. So, we are…

Q: Why do different species of animals have different numbers of chromosomes in their cells?

A: Chromosomes are the strands of DNA or genetic material. It is usually linear for macro-organisms and…

Q: Which of the following are characteristics of stem cells? Select all that apply.     --They can…

A: Stem cells are cells that have the potential to differentiate into any type of cell and can divide…

Q: A male of one species is bred multiple times to a female of a different species. No offspring are…

A: Cross-species breeding incompatibility is the inability of individuals from two different species to…

Q: We humans have a gene that, if enabled, would result in us growing a tail. Yet we do not grow tails.…

A: Alleles are the alternative forms of a gene thats are located on the same locus of homologous…

Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: The basic units of information that encode the proteins needed to grow and function as a living…

A: the basic unit of information that encodes the proteins needed to grow and function as a living…

Q: What is the difference between genes and chromosomes? Give examples!!!

A: The genes are comprised of DNA. A few genes gives guidelines to make molecules called proteins.…

Q: In a human body, kidney cells have a different DNA from the one present in the lung cells, because…

A: DNA is the genetic material which serve as a code for expression of life. All cells of human body…

Q: How is a male rather than a female zygote created? O The female produces a Y chromosome. The female…

A: A zygote is a cell stage that resulted due to the fertilization between two gametes i.e, male and…

Q: Genetics Question 3

A: The SRD5A2 gene provides instructions for making an enzyme called 5-alpha reductase 2. This enzyme…

Q: Do all genes have promoters?

A: In gene expression transcription is the first step. Transcription is the process of expressing genes…

Q: The origin of the 46 chromosomes in a human zygote is O all from the sperm cell. O half from DNA and…

A: The formation of zygote happens through a process called fertilization. Two haploid gametes fuse…

Q: An egg and similar share:     the same size     the same degree of mobility     the same…

A: An egg is female gamete and sperm is male gamete. Both are used in the process of progeny…

Q: What happens to the RNA primers found in newly synthesized DNA? Their nucleotides are converted to…

A: The making of DNA offspring from the parental DNA was termed DNA replication. During replication,…

Q: Humans have ___ matching chromosomes. A human cell contains these ___ chromosomes because we go…

A: To fill in the blanks

Q: How many pairs of chromosomes are found in human body cells? O 2 O 4 O 23 O 46

A: The inheritable molecule that passes from preceding generations to the subsequent generations is…

Q: The VH is different from the V₁ in what way? VH is heavier. VH uses an additional gene segment. VH…

A: One component of the antibody molecule that helps with its antigen-binding selectivity is the…

Q: Chromosomes are composed of DNA and proteins. Which one of these components did scientists FIRST…

A: Initially, scientists considered to be a fairly simple matter to hold the large amount of genetic…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.