What is the function for telomerase, a reverse transcriptase? O to recognize the tip of an existing telomere DNA and elongate it in the 3' to 5' direction, using its own RNA template O to recognize the tip of an existing telomere DNA and elongate it in the 5' to 3' direction, using its own RNA template to help synthesize a new DNA repeating strand that will attach to the telomere of the parental DNA strand to remove the existing telomere DNA to synthesize new telomeres with its own RNA template

What is the function for telomerase, a reverse transcriptase? O to recognize the tip of an existing telomere DNA and elongate it in the 3' to 5' direction, using its own RNA template O to recognize the tip of an existing telomere DNA and elongate it in the 5' to 3' direction, using its own RNA template to help synthesize a new DNA repeating strand that will attach to the telomere of the parental DNA strand to remove the existing telomere DNA to synthesize new telomeres with its own RNA template

Name: Help What is the function for telomerase, a reverse transcriptase?to r
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Help What is the function for telomerase, a reverse transcriptase?to recognize the tip of an existing telomere DNA and elongate it in the 3' to 5' direction, using its own RNA templateto recognize the tip of an existing telomere DNA and elongate it i

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

In order to avoid loss of DNA from the ends of linear chromosomes, telomerase directly adds extra copies of telomere repeats onto: O the 5' end of the leading strand O the 3' end of the lagging strand O both 5' and 3' end of the leading strand O the 3' end of the leading strand
What is the function of the Primase enzyme? To edit out primers at the end of DNA replication To separate strands of DNA for replication To synthesize a short sequence of RNA that is complimentary to the template DNA strand so that DNA polymerase has an OH group to work on To prime the DNA to get it ready for gene expression
Which of the following statement(s) correctly describe(s) telomerase? Select all that apply. You may select multiple options. ✔Telomerase synthesizes DNA from an RNA template. O All of these options O Telomerase extends the lengths of telomeres of linear chromosomes in eukaryotes. O Telomerase unwinds the DNA duplex at telomeres. Telomerase serves as a primer for DNA synthesis at telomeres. O Telomerase has 5'-to-3' exonuclease activity.
If a mutation occurred that prevented single stranded binding proteins from binding, the result would be: O Replication would not be initiated O DNA would be synthesized on the leading strand, but not the lagging strand Replicating would be initiated, DNA would unwind, RNA primers would be laid down, but DNA polymerase would not bind O The newly synthesized RNA would not be able to leave the DNA template Replication would be initiated, but RNA primers would not anneal to the DNA
How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Lagging strand: is synthesized discontinuously in the replication fork. direction toward the N terminal to the C terminal From the nitrogenous base to the phosphate group 5-> 3' 3'-> 5 direction toward the Leading strand: is synthesized continuously in the replication fork. N terminal to the C terminal From the nitrogenous base to the phosphate group 5-> 3' O 3'-> 5' How would the DNA sequence GCTATA be transcribed to MRNA? GCUAUA CGATAT CGAUAU O GCUTUT What bases would be found on the other strand of the DNA sequence GCTATA ? GCUAUA CGATAT CGAUAU GCUTUT O O O O O OO OO
Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP [1]
Telomerase adds nucleotides to the O 5' end of the parental strand O 3' end of the daughter strand O 3' end of the RNA primer O 3' end of the parental strand O 5' end of the daughter strand
Replication vs transcription Uses DNA as template to synthesis a polymer Synthesizes DNA strand(s) Forms phosphodiester bonds Requires a primer Low capacity for proofreading Works in conjunction with other proteins Faster More error prone DNA polymerase III RNA polymerase Transcription mRNA transcripts code for multiple genes Multiple types of RNA polymerase Create mRNA transcript from DNA Transcription in cytoplasm Pribnow box in promoter TATA box in promoter Untranslated regions (UTRs) Post translational modification Prokaryotes Eukaryotes
3-5-8-DNA- DNA helicase- DNA ligose-DNA polymerase-DNA replication origin of replication-primase-RNA-RNA polymerose- single strand binding protein stort codon-stop codon-transcription -transiation to What is the name of this process?1 This process bepins ar a site where the X's e on the DNAColed What is the name for #27 What is the neme for #3? 5 What is #4 made.cf at Which number refers to an Okazaki fracment? What is the number of the enzyme that is eluing toeether Okazaldi fragments"
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
Describe precisely the catalytic activity of DNA polymerase I that removes RNA primers. 3' to 5' exonuclease 5' to 3' exonuclease 5' to 3' endonuclease O 3' to 5' endonuclease