What is associative learning? What is one mutation in C. elegans that might disable associative learning in this species, and what is its human homolog?

Q: Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B)…

A: Amino acids are classified based on their properties like whether they are polar or nonpolar,…

Q: Some animals like C. elegans, do not have 5-methylcytosine, but do have methylated adenine. It is…

A: DNA methylation is known as epigenetic mechanism. It occurs when a methyl group is added to DNA and…

Q: What is open reading frame? How frame shift mutation can be happened? Explain with example.

A: The branch of science that deals with the study at the DNA and gene levels are termed genetics. It…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: How did mutations in the Drosophila ANT-C gene complex provide researchers with information on the…

A: The embryonic development of drosophila is regulated by differential gene expression. These flies…

Q: What are the best available databases for identification of alternatively spliced isoforms in human…

A: Genome sequencing means to determine the whole DNA sequence of the particular organism like the…

Q: What are some of the explanations for the finding that humans are a much more complex organism than…

A: Humans are more complex than roundworms.

Q: What is mutation in yeast?

A: Yeast is a eukaryotic unicellular organism that belongs to the kingdom Fungi. These organisms are…

Q: You sequence a gene in Drosophila melanogaster and D. simulans. You observe 5 non-synonymous…

A: Gene sequencing is used to determine the nucleotide order in a DNA molecule that makes up the…

Q: What was used in experiments to induce mutations in Drosophila in the 1920s? What is Drosophila?…

A: The gene named sc v f led to offspring which are having a different in eye color and found that they…

Q: The phenotype of a heterozygous mouse (Aa) is agouti.  The agouti banding pattern is due to altered…

A: * Homozygous dominant and Heterozygous will produce agouti that is AA or Aa respectively  and the…

Q: What is different about the C residues in CpG islands compared to C residues in the rest of the…

A: CpG dinucleotides are the short interspersed DNA sequences that are unevenly distributed throughout…

Q: Beadle and Tatum removed arginine and other substances from the nutrient medium of the mutated…

A: Beadle and Tatum experimentally proved the "one gene one enzyme" hypothesis. They took wild-type…

Q: what is the purpose of this experiment and the hypothesis of the paper?

A: The given experiment was performed to rearrange the segments of the DNA to study its effect on…

Q: What phenotypes do you think a homozygous tra1hsn animal with a gain of function mutation in the…

A: Mutation changes genotype frequencies by continually implementing new alleles, that can be…

Q: How might P-elements have entered Drosophila melanogaster?What do you know about P-element…

A: P elements are transposable elements that were discovered in Drosophila as the causative agents of…

Q: The HbβS(sickle-cell) allele of the human β-globingene changes the sixth amino acid in the…

A: Sickle cell anemia is a blood disorder in which an improper folding of hemoglobin occurs. In this…

Q: What happens if there is too much p16-ink4a in a juvenile and elderly human? what happens if a…

A: Introduction:- The unregulated and abnormal proliferation of normal cells results into the formation…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other…

A: Hi! As you have posted multiple questions, I will be answering the first question for you. If you…

Q: How did Covid-19 influence the rapid adoption of telemedicine.

A: The term "telemedicine" describes the use of telecommunications technology to provide medical…

Q: O A. Screen thousands of strains for a spontaneous unc-22 mutation O B. Soak worms in mutagenic…

A: In RNA silencing microorganisms are used to silence or negatively affect the gene expression. It is…

Q: Give one example of Adductors?

A: The body movement is controlled by the muscular system.

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.