What enzyme synthesizes small primers for DNA polymerase to bind to so it can initiate DNA replication. What are these primers made of? To answer the question please: I) name the proteins that are required for DNA replication; 2) draw a scheme of DNA replication; 3) design a primer for this DNA fragment: 5'-AATTGGCA-3
Q: A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a…
A: in prokaryotes, the genomic DNA is in a circular format and adopt the theta replication model,…
Q: What enzyme is responsible for unzipping the DNA during replication?
A: DNA replication is process of synthesizing daughter DNA strands from parent strand in order to store…
Q: In the Meselson–Stahl experiment thatestablished the semiconservative nature of DNA replication,the…
A: Replication follows the semiconservative mode, which was proved by the experiment conducted by…
Q: If a eukaryotic chromosome has 25 origins of replication, how many replication forks does it have at…
A: Deoxyribonucleic acid (DNA) replication is the biological process by which a double-stranded DNA…
Q: Name of a few enzymes involved in DNA replication other than DSNA polymerase and ligase.name the key…
A: Each cell follows central dogma to undergo division and growth. The central dogma has three main…
Q: Between which types of compounds in a double-stranded DNA molecule must the bonds break before…
A: -DNA replication is the biologucal process of producing two identical replicas of DNA from one…
Q: What is the first step in the process of DNA replication? Which enzyme is responsible for…
A: Your question has 4 subparts. I will answer first 3 subparts, as per guidelines. DNA replication of…
Q: What is a replication fork? Why is it important in replication?
A: Replication is the process where the double-helical structure of DNA acts as a template for the…
Q: Which protein directs the recombination exchange with a DNA that has failed a complete DNA…
A: DNA unwinds and the two strands detach at the "replication origins" a little at a time, like a…
Q: During DNA replication, why doesn’t DNA polymerase move away from the replication fork on both…
A: When the replication of the DNA takes place, an enzyme called helicase begins to unwind the double…
Q: During DNA replication, the two new daughter DNA strands have to be made at the same time in the…
A: Answer: DNA REPLICATION = This is the first step in the central dogma in DNA, where new daughter…
Q: Which strand(s) in the DNA Replication Fork depicted below represent the parent strands?
A: DNA replication is the process by which a double stranded DNA (dsDNA) makes a copy of itself to…
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: Okazaki fragments are short stretches of DNA on the lagging strand, which are synthesized in the…
Q: How is DNA synthesis in the Polymerase Chain reaction similar to, or different from, DNA synthesis…
A: DNA replication is a process that takes place in every biological cell. It involves the copying and…
Q: DNA replication begins on a double helix at specific sites, called origins of replication where DNA…
A: DNA replication is the process through which two identical DNA helixes are generated from a single…
Q: Explain how the lagging dna strand is copied during dna replication? What are the enzymes involved?
A: The nascent deoxyribonucleic acid (DNA) consists of one leading strand and one lagging strand.
Q: Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA…
A: DNA replication is the process of copying the DNA molecule using parental DNA molecule as template.…
Q: Which of the following statements about DNA replication is FALSE? Select one: Unwinding of the…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: Suppose that 28% of the nucleotides in a DNA molecule are deoxythymidine 5′- monophosphate, and that…
A: DNA is a double stranded helical polynucleotide. It usually consists of two helices, sequences of…
Q: Which of the following enzymes is responsible for "exposing" or "unwinding" the DNA template (taking…
A: Deoxyribonucleic acid is a molecule which comprises of two polynucleotide chains that wound around…
Q: Why is DNA gyrase necessary for replication?
A: DNA gyrase is an enzyme of class topoisomerase and subclass of topoisomerase type II. DNA…
Q: In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible )…
A: The DNA (deoxyribonucleic acid) is composed of nucleotides that are in turn made up of nitrogenous…
Q: Hello, can you help and explain to me what the difference between agglutination and coagulation? And…
A: Dna replication is the process of converting two parents strands of the double helical dna into two…
Q: If the gene for primase were mutated so that no functional primase was produced, what would be the…
A: The process of DNA replication is essential during the cell division cycle in both the eukaryotic as…
Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…
A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…
Q: In what order does initiation of DNA replication proceed (from 1 = first to 4 = last)?…
A: DNA unwinds at the origin of the replication. DNA is a double helix strand and the two strands are…
Q: What is the BEST explanation for why DNA replication is discontinuous at the lagging strand? А. DNA…
A: DNA possesses information for an individual to develop, survive and reproduce. The hetero catalytic…
Q: What is difference between the leading and lagging strands in DNA replication? Which? -Okazaki…
A: DNA replication is a process by which DNA is copied. It occurs mainly in S phase of cell cycle.…
Q: Describe in order, the four repeating steps that repeat over and over on the discontinuous lagging…
A: Replication: it is the process by which new DNA is produced from the old DNA by semi-conservative…
Q: During DNA replication, the function of RNA primers is to Group of answer choices serve as a…
A: DNA replication is the process by which two copies of DNA is produced from a parent DNA molecule. It…
Q: what if a mutation resulted in the enzyme DNA polymerase III being non-functional? How would that…
A: The mutation is defined as the change in sequence of nucleotides in a gene. The mutation can either…
Q: Does E. coli chromosomal replication always start at one particular site? What is called? If you…
A: The initiation of replication process occurs from a specific region and it proceeds…
Q: How is DNA replication initiated in prokaryotes and eukaryotes? How is this process controlled and…
A: Deoxyribonucleic acid (DNA) is the genetic material found inside a cell's nucleus. The production of…
Q: As a result of DNA replication two DNA molecules come into existence. Why is it not correct to…
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…
Q: Why Are There So Many DNA Polymerases?
A: DNA polymerases are the sole enzymes which duplicates the genetic information in the nucleic…
Q: Which of the following enzymes has a major role in joining of DNA fragments (Okasaki fragments)…
A: DNA gyrase - It is an bacterial bacterial enzyme that reduces the topological strain in ATP.…
Q: Place the following steps of DNA replication in order (from left to right) from the beginning to the…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…
A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…
Q: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer…
A: Ligase unwinds the helical structure of DNA. Topoisomerase breaks the pressure of supercoiling in…
Q: The speed of DNA replication at a replication fork is about 100 nucleotides per second in human…
A: Introduction :- The process by which the genome's DNA is copied in cells is known as DNA…
Q: What features of the structure of DNA enable it to be replicated?
A: Biomolecules are organic compounds found in living organisms. Examples of biomolecules includes…
Q: Regarding the process of DNA replication, is it correct to state that: (Only one statement is…
A: (c) DNA polymerase requires a previously annealed deoxynucleotide to add the next monomer being…
Q: Using the correct base pairing rules for DNA replication, what would be the complementary strand for…
A: Rules of base pairing A with T: The purine adenine(A) always pairs with the pyrimidine Thymine…
Q: What is one enzyme that is involved with DNA replication and how would the absence of this enzyme…
A: Introduction: Nucleic acids are major macromolecule present in the nucleus of the cell. DNA is a…
Q: What is the role of topoisomerase during DNA replication? To cut and re-glue (ligate) DNA, to…
A: Answer :- To cut and re-glue(ligate) DNA, to relieve coiling strain on the double helix ahead of the…
Q: In terms of the new DNA strands that are generated, what are the differences between replication and…
A: DNA replication is a biological process which produces two identical DNA from the one original…
Q: Why are primers required in DNA replication but not in transcription
A: DNA replication is a process that takes place inside the nucleus of the cell. During replication the…
Q: Why must replication of DNA proceed in two opposite directions? And what differs about how DNA…
A: DNA replication It is defined as the biological process of generating two similar copies of DNA…
Step by step
Solved in 2 steps with 2 images
- Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.
- 19. Match the letters with the enzymes and macromolecules involved in DNA replication: A E B DNA POLYMERASE CATALYZES COMALENT LINKAGE OF NUCLEOSIDE TRIPHOSPHATE INTO GROWING NEW STRAND INCOMING NUCLEOSIDE D' TRIPHOSPHATE PAIRS WITH A BASE IN THE TEMPLATE STRAND A) i) pyrophosphate (Pi) ii) template strand ii) incoming nucleoside triphosphate iv) new strand v) DNA polymerase1)give 3 differences between replication in prokaryotes and replication in Eukaryotes 2)For each item in the following table, decide whether it is related or involved in transcription, translation or replication. 1. Splicing 2. Stop codon 3. Lagging strand 4. RNA polymerase 5. DNA polymerase 6. Telomerase 3) Give the mRNA and the polypeptide (amino acid sequence) that results from the following DNA template strand: DNA template T A C A C G G G C G T A mRNA Amino acid sequence(d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II
- 1. TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand. b) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand.1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of polymerization and therefore better suited for replication of the genome" What is meant by processivity? how does the DNA polymerase 3 maintain high processivity? b) What is a replication fork ?. Give the protein/enzymes of a replication fork and describe their function?
- Please match the following enzymes with their correct functions. Primase, Gyrase, Ligase, Polymerase, Helicase, Topoisomerase 1.Unwinds DNA at the replication fork. 2.Makes and reseal breaks in the double-helical DNA to release the torque that builds up as a result of unwinding at the replication fork. 3.Synthesizes a short RNA to provide a 3’ -OH group for the attachment of DNA nucleotides. 4.Removed RNA primers and replace them with DNA. 5.Joins Okazaki fragments.a) Explain how the molecular mechanism of DNA polymerase enhances DNA replication. b) Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? 2.) The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? 3.) What will be the tRNA anticodon based on your answer in item 2? 4.) what is the amino acid chain that your answer in item 2 will dictate? 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1.