Q: What labels goes to active immunity and passive immunity
A: Immune response is the physiologial process which involves our body immune cells to identify and…
Q: How do you compute maximum electron transport (Jmax) and what does the value tell you about the…
A: Answer : we calculate maximum electron transport (Jmax) by non-rectangular hyperbolic model (termed…
Q: What does your map of cutaneous sensations tell you about the distribution of sensory receptors in…
A: Introduction - Skin - heaviest organ in the body- Protects the organism by keeping damaging agents…
Q: True or false Nociceptors directly detect bacterial pathogens and their products
A: Nociceptors are sensory neurons which are specialized to sense those stimuli which are potentially…
Q: The diagrams represent four possible phylogenetic relationship between the four species: M, L, S,…
A: The phylogenetic tree represents the evolutionary relationship between taxons in the phylogeny. It…
Q: Explain what are the advantages and disadavatges of the CIN, MSI, CIMP pathways and the inflammatory…
A: The Mendelian gene is a basic unit of heredity and the molecular gene is a sequence of nucleotides…
Q: 1. List 3 sustainable practices for a healthy future and healthy environment. 2. Write 3 ways these…
A: 1- Don't throw garbage on street. Always carry a bag for your garbage or throw garbage in public…
Q: 2. On your drawing of glucose, circle and label the hydroxyl groups. What does the presence of…
A: Carbohydrates are polyhydroxy aldoses, ketoses and their derivatives that yield such compounds and…
Q: explain what can be the future developments of curing adenocarcinoma tumours in regard to (colon)…
A: A group of benign (noncancerous) cells collectively known as an adenomatous polyp is the primary…
Q: How do cats drink?
A: Answer : Cats drink water by what we call cat's lapping stratigy.Water stuck to the tip of a cat's…
Q: The type VI secretion system evolved from: please explain and choice the right answer porins…
A: Introduction Bacteria belongs to the kingdom Monera. Bacteria are unicellular and prokaryotic…
Q: When reviewing a Michaelis-Menten Saturation Curve, at first the rate of the reaction is relatively…
A: Michaelias- Menten curve is plotted by taking reaction rate along y axis. The substrate…
Q: During Pavlov's experiment, after many pairings of the sound of the bell and presentation of food,…
A: The term Cognition refers to the ability to acquire, think, process, understand, and remember…
Q: Stomach Which foods are digested here ? Which nutrients are absorbed here ? Which cells make up the…
A: The stomach appears as a J-shaped organ that aids in the digestion of food. Stomach produces various…
Q: What is the importance of MSH1 and MSH2 in regards to adenocarcinoma.( colorectal cancer)
A: MSH1- The msh1 gene is responsible for short life span mutant natural death and functions to…
Q: Illustrate the chromosome changes in interphase and mitosis using a diploid cell that is 2n=4 (two…
A: Mitosis is a type of cell division in which one mother cell divides to produce two new daughter…
Q: The modern human skull is: Select an answer and submit. For keyboard navigation, use th a The one…
A:
Q: Renko studied diffusion of tracer molecules to study paracellular diffusion across an epithelial…
A: The movement of molecules across an epithelium by passing through the intercellular space that…
Q: If a genetic female fetus is exposed to testosterone in utero, would that individual develop a…
A: Men have noticeably more testosterone on average than women, despite the fact that testosterone is…
Q: Draw the Prophase I pairing conformation that would result from this translocation. The four types…
A:
Q: What is different about prophase I and prophase II of meiosis?
A: Cell division is the process through which new daughter cells are formed from the parent cells. It…
Q: B. Let's assume that a small proportion of the homozygote ss individuals do survive and reproduce,…
A: According to the Hardy-Weinberg equilibrium, if no unfavorable forces exist, genetic variation in a…
Q: 1. What are enzymes? 2. Why are they catalysts? 3. How many digestive enzymes does the body produce?…
A: Every living cells perform different activities that keeps the cell alive. Difficult different…
Q: why is the maintenance of homeostasis especially important during development of new umans within…
A: Maintenance of homeostatis is very important in fetuses . The placenta plays a very important role…
Q: Assume that long fingers are Inherited as a recessive trait with an 80% penetrance. Two people…
A: The percentage of people with a specific genotype who also displayed the predicted phenotype is…
Q: Identify 2 or more DNA-based technologies and discuss their combined applications in…
A: We need to discuss the combined uses of two technologies in the generation/development of a DNA…
Q: Perspective on any ethical considerations which engineers should consider when developing code to…
A: A code of ethics is a collection of guiding principles designed to teach professionals how to…
Q: One form of posttranscriptional modification of most eukaryotic pre-mRNAs is the addition of a…
A: Introduction:- Transcription is the synthesis of RNA molecules. After the completion of…
Q: The brain is particularly sensitive to being shaped by input from the environment during sensitive…
A: Developmental psychology is a discipline of psychology that is concerned with the processes and…
Q: Consider a solute having a permeability coefficient of 10-6 m s-1 for the plasma membrane of a…
A: Diffusion is the process of movement of solutes from an area of high concentration to a low…
Q: graduate student wants to isolate cells from a patient and grow them perpetually in culture to study…
A: The correct answers are as follows- A. Telomerase C. MDM2 A graduate student wants to isolate cells…
Q: Small intestine How long is it ? Which segments make up the small intestine? Which foods are…
A: Small intestine is a main part of gastrointestinal tract. It serves for the absorption of various…
Q: "Earth Overshoot Day" is most closely related to which of the following concepts? O A. Carrying…
A: Earth Overshoot Day is a calculated date on which humanity has consumed all the biological resources…
Q: Acetyl Coa is a ____ carbon molecule derived from pyruvate that is used during ______. Select one:…
A: The aerobic respiration process breaks down the glucose into ATP.
Q: The sodium-glucose cotransporter is an example of _____________. The Na/K pump participates in…
A: Cell membrane is being a semi- permeable in nature selectively allows the substance to move in and…
Q: describe the process of mitosis
A: Cell cycle is a series of events the produce parent cell into daughter cells.
Q: Enzymes catalyze chemical reactions by lowering the __________ a. Energy of activation b.…
A: Introduction : The body produces enzymes, which are basically proteins, to carry out specific…
Q: I have a biology, question: In aerobic respiration, energy is harvested from glucose molecules in a…
A: Introduction :- When nutrients are broken down aerobically into carbon dioxide, water, and energy,…
Q: Ozana was born with cataracts, which made her completely blind. When she was 14 years-old she…
A: Neuroplasticity, also known as brain plasticity, is the ability of the brain's biological, chemical,…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: What components are important for making a lipid membrane? please explain the answer and choice the…
A: Cell membrane/ plasma membrane is the curtain that separates the interior portion of cell from the…
Q: Small intestine 1. How long is it ? Which segments make up the small intestine? Which foods are…
A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…
Q: Common OTC medication doses for children are determined by referring to a manufacturer-provided…
A: OTC medicines are Over The Counter medicines which can be sold to a patient without producing a…
Q: The enzymes of the citric acid cycle are located in the a. Inter membrane space of mitochondria…
A: The citric acid cycle is an important metabolic route that links the metabolism of proteins, fats,…
Q: se cats, and they began 7,000 individual months. These eat rodents and ater supplies. hanges in t,…
A: The kit fox is one of a fox species that inhabits arid and semi-arid regions of the southwestern…
Q: The SecB protein helps export proteins by:
A: In molecular biology, molecular chaperones are proteins that help big proteins or macromolecular…
Q: The role of NAD+ in cellular respiration is to move high-energy neutrons during the breakdown of…
A: Oxygen is required for cellular respiration and the metabolism of dietary energy (oxidative…
Q: Where does the following reaction take place: isomerization of the 6-carbon molecule citrate Select…
A: The production of intermediate cis-aconitase converts citrate to isocitrate.This is a reversible…
Q: purple kernel color, while the homozygous recessive genotype causes red kernel color. If corn plants…
A: Given :- Dominant allele Z and recessive allele z Dominant allele cause purple colour and the…
Q: Observe the species in your surroundings, take a picture of the leaves of at least three plant…
A: In given question three type of leaves given of Aloe Vera,organo and Banana leaves. Base is bottom…
Step by step
Solved in 2 steps
- Which component of a homeostatic control mechanism would the life function "responsiveness" be best associated with? O effector O gland O receptor O muscle none of the above Next ► « PreviousWhat is homeostasis? Whatare the sensors, controllersand effectors of homeostasis?What are the effects of homeostatic control systems?
- Homeostasis is best described as maintaining a(n): O stable and optimal internal environment O deviation in the internal environment O fixed, constant internal environment O internal environment that matches the external environment state of equilibrium between the external and internal environmentHomeostasis can be defined in which of the following ways: using the least amount of energy maintaining a stable internal environment within narrow limits regardless of environmental changes O maintenance of a static state with no deviation from predetermined set points a dynamic state within an unlimited range, depending on circumstances O more than one of the above Next » « PreviousWhich of the following statement(s) about homeostasis is incorrect? a. it is a dynamic state of equilibriumb. despite continuous external changes, it maintains a relatively stable internal environmentc. controlled by nervous and endocrine systems via nerve impulses and hormones, respectivelyd. all of the abovee. none of the above
- What is homeostasisand how it is controlled? Give examples of ;•A negative feedback control mechanism •A positive feedback control mechanismwhat happens during extremes that Force bodies out of homeostatic bodies? OurHomeostatic means: O Keep variables exactly at the set point O Maintain a relatively constant internal environment O Act to keep values out of the normal range O Produce a disease condition