what are the implecations of 'aerodynamic diameter 'of asbestos fibers?

Q: A pain near the breast area?

A: The pain near the breast area is a common issue faced by several women, and the cause behind this…

Q: Treatment of neutropenia

A: Neutopenia refers to low or decrease number of count of WBC special in neutrophils cells .

Q: 24kg= Ibs

A: A kilogram (kg) is said to be 2.2 times heavier than a pound (represented as lbs).Thus, one kilo of…

Q: what are various blood conditions

A: Blood is a fluid connective tissue that carries oxygen, glucose, and nutrients throughout the body.…

Q: disease this patient suffer from

A: Stroke is a medical condition in which cells die when there is insufficient blood flow to the brain.…

Q: differences between AKI vs CRK

A: Kidneys are the major excretory organs located in the retroperitoneal space. One kidney is located…

Q: Explain to Anthony mother what a clean wound is-

A: Wounds are classified into four categories based on how contaminated they are,  the risk of…

Q: Altered gene function, on hemophilia A

A: A genetic bleeding disorder called haemophilia A, also called classical haemophilia, is brought on…

Q: Loss of heterozygosity of tumor suppressor gene_______________

A: Loss of heterozygosity -It is the loss of one parent's contribution to cell and can be caused by…

Q: How was HIV finally identified?

A: The source of HIV in human was found in a chimpanzee in West Africa.  Scientist believes that…

Q: What is Scarlett fever

A: Scarlet fever is a bacterial illness that can cause a rash and fever. It is most common in children,…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Mutation on hemophilia a

A: Hemophilia A is most often a genetic disorder. This means that it’s caused by changes (mutations) to…